TkA03G021020 | RubberDandelionOmics

Gene overview

TkA03G021020

Reference: TK1151 Chr: Chr03 Coordinates: 5423143-5426876 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2043 bp · TkA03G021020|TK1151|cDNA

ATGGAGTCCTCTTCGAGTTTCAAAGTGAAGGTTAGACGAAAATGCTATATTCCTGGTGCAATTTTTGGTCCATTTTCATTCATCAACATATATTCAGGAAAAAAGGTTGTTGATGCTGAAAATGGCATGAAAAACATGATCGAGGTCGCGGTTACTTTGCGGATACTTCAGTTACTCTATAAAGAATGTTCGTCATCAAAGCAGAAGATTAGCATTGCGGTGTTATCGCCAAACCTTTCTCAACTTCAATCTCTGCAACA...

CDS

Download CDS FASTA

2043 bp · TkA03G021020|TK1151|CDS

ATGGAGTCCTCTTCGAGTTTCAAAGTGAAGGTTAGACGAAAATGCTATATTCCTGGTGCAATTTTTGGTCCATTTTCATTCATCAACATATATTCAGGAAAAAAGGTTGTTGATGCTGAAAATGGCATGAAAAACATGATCGAGGTCGCGGTTACTTTGCGGATACTTCAGTTACTCTATAAAGAATGTTCGTCATCAAAGCAGAAGATTAGCATTGCGGTGTTATCGCCAAACCTTTCTCAACTTCAATCTCTGCAACA...

Protein

Download Protein FASTA

680 aa · TkA03G021020|TK1151|PROTEIN

MESSSSFKVKVRRKCYIPGAIFGPFSFINIYSGKKVVDAENGMKNMIEVAVTLRILQLLYKECSSSKQKISIAVLSPNLSQLQSLQQKIEIHYENNEFLKVKVGFFHDYKGTDDVVLVSTVGSDGDERYDVVNINGYLKSERRCLWILGDERVLQKGGSKWEPLILEAKARRCFFQADEHKDLAKVIVEVKKDLDELDELLIGESSLFKSTTWKVLFSSKFVTSFSNIESWETKKLVLLMLRKLSSGWRPKQGSTAACIV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G021020`
TK1151 ID	TkA03G021020
OH-1004 ID	LXL04_006247
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	87.800
Protein coverage (%)	TK1151 96.324 / OH-1004 28.799 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G021020`
Location	Chr03:5423143-5426876 (+)
Description	Similar to TRANK1: TPR and ankyrin repeat-containing protein 1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_006247` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	hsa:9881 mmu:320429 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.785

Rank 1 · TkA03G021020 · TK1151

Cytoplasm0.210

Rank 2 · TkA03G021020 · TK1151

Mitochondrion0.040

Rank 3 · TkA03G021020 · TK1151

Cell membrane0.031

Rank 4 · TkA03G021020 · TK1151

Endoplasmic reticulum0.019

Rank 5 · TkA03G021020 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13087AAA_1222-143 aa

PF14663RasGEF_N_250-92 aa

PF23875DUF7229139-187 aa

PF14663RasGEF_N_2179-223 aa

PF11496HDA2-3186-209 aa

PF13555AAA_29199-211 aa

PF14663RasGEF_N_2368-394 aa

PF00580UvrD-helicase414-446 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G021020	`PF13087`	AAA_12	22	143	5e-08	33.5
TkA03G021020	`PF14663`	RasGEF_N_2	50	92	0.066	14.3
TkA03G021020	`PF23875`	DUF7229	139	187	0.095	13.6
TkA03G021020	`PF14663`	RasGEF_N_2	179	223	0.066	14.3
TkA03G021020	`PF11496`	HDA2-3	186	209	0.046	13.6
TkA03G021020	`PF13555`	AAA_29	199	211	0.23	12.0
TkA03G021020	`PF14663`	RasGEF_N_2	368	394	0.066	14.3
TkA03G021020	`PF00580`	UvrD-helicase	414	446	0.045	14.1
TkA03G021020	`PF13555`	AAA_29	420	441	0.23	12.0
TkA03G021020	`PF13401`	AAA_22	427	519	0.073	14.1
TkA03G021020	`PF23875`	DUF7229	460	479	0.095	13.6
TkA03G021020	`PF11496`	HDA2-3	575	675	0.046	13.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card