TkA03G017770 | RubberDandelionOmics

Gene overview

TkA03G017770

Reference: TK1151 Chr: Chr03 Coordinates: 4676276-4688258 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3446 bp · TkA03G017770|TK1151|cDNA

TGCTCGAATACTACACTATTACAAACACGTCACCCTCACACTTTTCCTCTTTTTAGTCAGGTATCACCGACGACAACGTTTCCTGCCTTCTTTCCACCGAGTAATTTCTCGTTTTTTCTTTCTGGAATACGTAAGTGATTCGTGTATAAGAAGGCGTACATTTTGAGAGATCGGTAGAGATGGCGGAGAGAAAGGAGAAGGATGACGTGGACAGGAAGATCACGATTGGCGTTTGCGTTATGGAAAAGAAGGTGAAATGC...

CDS

Download CDS FASTA

3195 bp · TkA03G017770|TK1151|CDS

ATGGCGGAGAGAAAGGAGAAGGATGACGTGGACAGGAAGATCACGATTGGCGTTTGCGTTATGGAAAAGAAGGTGAAATGCGGCCTGGAGGTTTTCTCGGCGCCTATGGGGCAAATTCTGGAAAGGTTGCAAGCTTTTGGTGAATTTGAGATCATCCATTTCGGGGACAGAGTTATCCTAGAGGAACCTGTAGAGAGGTGGCCAATATGTGATTGTTTGATTGCTTTCCATTCTTCTGGGTATCCACTTGAAAAAGCTGA...

Protein

Download Protein FASTA

1064 aa · TkA03G017770|TK1151|PROTEIN

MAERKEKDDVDRKITIGVCVMEKKVKCGLEVFSAPMGQILERLQAFGEFEIIHFGDRVILEEPVERWPICDCLIAFHSSGYPLEKAEAYAALRKPFLVNELEQQHLLHDRRKVYECLESFGIPVPRYALVNREKPYQDLDYFVEEEDFVEVHGQRFGKPFVEKPIHGDDHSIMIYYPSSAGGGMKELFRKVGNRSSEFHPEVRRVRRESSYIYEEFMPTGGTDVKVYTVGPEYAHAEARKSPVVDGVVMRNPDGKEVRYP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G017770`
TK1151 ID	TkA03G017770
OH-1004 ID	LXL04_006217
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G017770

Location Chr03:4676276-4688258 (-)

Description Similar to VIP2: Inositol hexakisphosphate and diphosphoinositol-pentakisphosphate kinase VIP2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g15070`	Bifunctional inositol kinase that acts in concert with the IP6K kinases to synthesize the diphosphate group-containing inositol pyrophosphates diphosphoinositol pentakisphosphate, PP-InsP5, and bis-diphosphoinositol tetrakisphosphate, (PP)2-InsP4.	No verified direct reference in this release
`At3g01310`	Bifunctional inositol kinase that acts in concert with the IP6K kinases to synthesize the diphosphate group-containing inositol pyrophosphates diphosphoinositol pentakisphosphate, PP-InsP5, and bis- diphosphoinositol tetrakisphosphate, (PP)2-InsP4.	Genetic basis for natural variation in seed vitamin E levels in Arabidopsis thaliana.2006 · DOI: 10.1073/pnas.0606221103 VIH2 Regulates the Synthesis of Inositol Pyrophosphate InsP8 and Jasmonate-Dependent Defenses in Arabidopsis.2015 · DOI: 10.1105/tpc.114.135160

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006217 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006020 inositol metabolic process Biological Process

GO:0009861 jasmonic acid and ethylene-dependent systemic resistance Biological Process

GO:0032958 inositol phosphate biosynthetic process Biological Process

GO:0050832 defense response to fungus Biological Process

GO:1900367 positive regulation of defense response to insect Biological Process

GO:1904966 positive regulation of vitamin E biosynthetic process Biological Process

GO:1905036 positive regulation of antifungal innate immune response Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009536 plastid Cellular Component

GO:0000827 inositol-1,3,4,5,6-pentakisphosphate kinase activity Molecular Function

KEGG gene cross-reference

ath:AT3G01310

ath:AT5G15070

dme:Dmel_CG14616

mmu:227399

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.542

Rank 1 · TkA03G017770 · TK1151

Nucleus0.309

Rank 2 · TkA03G017770 · TK1151

Cell membrane0.181

Rank 3 · TkA03G017770 · TK1151

Mitochondrion0.114

Rank 4 · TkA03G017770 · TK1151

Endoplasmic reticulum0.076

Rank 5 · TkA03G017770 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF18086PPIP5K2_N14-109 aa

PF08443RimK246-308 aa

PF00328His_Phos_2369-952 aa

PF01114Colipase790-820 aa

PF13299CPSF100_C802-912 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G017770	`PF18086`	PPIP5K2_N	14	109	1.9e-36	124.8
TkA03G017770	`PF08443`	RimK	246	308	0.025	14.9
TkA03G017770	`PF00328`	His_Phos_2	369	952	6.4e-72	243.6
TkA03G017770	`PF01114`	Colipase	790	820	0.2	12.1
TkA03G017770	`PF13299`	CPSF100_C	802	912	0.0033	18.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84WW3`	Arabidopsis thaliana	sp\|Q84WW3\|VIP2L_ARATH Inositol hexakisphosphate and diphosphoinositol-pentakisphosphate kinase VIP2	81.600%	Swiss-Prot	High
`F4J8C6`	Arabidopsis thaliana	sp\|F4J8C6\|VIP1L_ARATH Inositol hexakisphosphate and diphosphoinositol-pentakisphosphate kinase VIP1	81.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card