TkA03G014970 | RubberDandelionOmics

Gene overview

TkA03G014970

Reference: TK1151 Chr: Chr03 Coordinates: 3867997-3872400 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1133 bp · TkA03G014970|TK1151|cDNA

AAAAGGCAATGAGCATGTTCAAGTTGAATACTTTCGCGTCAATAAGCCCAAAACCTTTATAGGAATCCTGTAAAAAATCAGTATTTGGGGTTAATTAGCTAGGGCAAACTCTAGACTCTTCGCAGTCATCAATGGCGGATGAAAACGACGCGTTTTACGTCGTCAGGAAAGGCGACATTGTTGGCGTGTACAAAAGTTTGACTGATTGCCAGCCTCTGTTATGTGGTTCAGACGTTGATGTTTTCAAAGGCTATAGATTG...

CDS

Download CDS FASTA

822 bp · TkA03G014970|TK1151|CDS

ATGGCGGATGAAAACGACGCGTTTTACGTCGTCAGGAAAGGCGACATTGTTGGCGTGTACAAAAGTTTGACTGATTGCCAGCCTCTGTTATGTGGTTCAGACGTTGATGTTTTCAAAGGCTATAGATTGTCTAAAACTGCTGAAAATTTTCTTGCCTCACATGGACTCAGTAGTGCGATATATTCAGTTGGTGTTTCTAATTTGCAACGTGAACATTTTGGTCAACTTATTCCTTGTCCATTTCAGCAACCAGTTTCCGT...

Protein

Download Protein FASTA

273 aa · TkA03G014970|TK1151|PROTEIN

MADENDAFYVVRKGDIVGVYKSLTDCQPLLCGSDVDVFKGYRLSKTAENFLASHGLSSAIYSVGVSNLQREHFGQLIPCPFQQPVSVNSKTPAENKIKKDIGSTTLSEAPKRNIPQTESFIEALPVSAYCCSCIVEFDGAAKGNPGPAGAGAVIRAVDGSLVYRVREGLGVATNNVAEYRAAILGLRYALERGFRHIRVQGDSKLVCMQVNGLWKTKTQNMADLCRVVKELKDKFMSFQICHVEREYNSEADAQANLGVY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G014970`
TK1151 ID	TkA03G014970
OH-1004 ID	LXL04_006173
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G014970`
Location	Chr03:3867997-3872400 (+)
Description	Similar to rnhA: Ribonuclease HI (Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_006173` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006401 RNA catabolic process Biological Process GO:0005737 cytoplasm Cellular Component GO:0003676 nucleic acid binding Molecular Function GO:0003677 DNA binding Molecular Function GO:0003723 RNA binding Molecular Function GO:0004523 RNA-DNA hybrid ribonuclease activity Molecular Function GO:0004527 exonuclease activity Molecular Function GO:0016791 phosphatase activity Molecular Function GO:0032296 double-stranded RNA-specific ribonuclease activity Molecular Function GO:0043755 alpha-ribazole phosphatase activity Molecular Function GO:0046872 metal ion binding Molecular Function GO:0071667 DNA/RNA hybrid binding Molecular Function
KEGG gene cross-reference	hal:VNG_0255C mbo:BQ2027_MB2253C mtc:MT2287 mtu:Rv2228c mtv:RVBD_2228c sto:STK_07530 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.585

Rank 1 · TkA03G014970 · TK1151

Nucleus0.435

Rank 2 · TkA03G014970 · TK1151

Mitochondrion0.070

Rank 3 · TkA03G014970 · TK1151

Cell membrane0.067

Rank 4 · TkA03G014970 · TK1151

Endoplasmic reticulum0.060

Rank 5 · TkA03G014970 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01693Cauli_VI8-51 aa

PF24953DUF776241-67 aa

PF13456RVT_3137-256 aa

PF00075RNase_H137-230 aa

PF24953DUF7762203-229 aa

PF17815PDZ_3206-240 aa

PF01693Cauli_VI246-255 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G014970	`PF01693`	Cauli_VI	8	51	7.5e-06	26.8
TkA03G014970	`PF24953`	DUF7762	41	67	0.18	12.7
TkA03G014970	`PF13456`	RVT_3	137	256	1.2e-25	90.5
TkA03G014970	`PF00075`	RNase_H	137	230	3.4e-08	34.5
TkA03G014970	`PF24953`	DUF7762	203	229	0.18	12.7
TkA03G014970	`PF17815`	PDZ_3	206	240	0.18	12.3
TkA03G014970	`PF01693`	Cauli_VI	246	255	7.5e-06	26.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card