TkA03G014360 | RubberDandelionOmics

Gene overview

TkA03G014360

Reference: TK1151 Chr: Chr03 Coordinates: 3708986-3711155 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1976 bp · TkA03G014360|TK1151|cDNA

CAAATGCTCATCAATTTGTTATTAAGAAGATCAGCAATTACAAAATAGAAAGAAATATAAAACATATACTCTGTATTTTCAAATAGTTGAAAATAACTAAACATTAAAACCTTTGATACATAAATGGCAGTATTGGATTTTTCCAGTTGGATCCAAACTCCTTAACTTATCGATTTGATGCTACAACTTCATCCTTTTCTTTAGTGCTTTCATCCTTTGACTCTACTGATGGTTTAATTTTAGACAAAGAGTCGACATCA...

CDS

Download CDS FASTA

1122 bp · TkA03G014360|TK1151|CDS

ATGGTGAGTTTCCGGCACACAAATGTGATGAAATATCAAATCTATAAGGAAGATGGGTTTGTCGGATTCCAACAATCGACGCCGTATCCGCCATCTCCGCCGTCTGTTCAGTCATATTCACCGCCGTTTACAGTCACCTTCCATAGAGCATCAGCTTCTTCATCTTCTTCCGGCCCCAAAATCAGCCCGGCTGTTCTGTTCATCATCGTGATTTTGGCCGTTTTGTTCTTCATCTCCGGTTTGCTTCACTTATTGGTTAG...

Protein

Download Protein FASTA

373 aa · TkA03G014360|TK1151|PROTEIN

MVSFRHTNVMKYQIYKEDGFVGFQQSTPYPPSPPSVQSYSPPFTVTFHRASASSSSSGPKISPAVLFIIVILAVLFFISGLLHLLVRFLTKHNSQSQSNRFPDGSPSETLQRQLQQLFHLHDSGLDQTFIDALPVFMYKEVVGAHEPFDCAVCLCEFSENDKLRLLPTCSHAFHISCIDTWLLSNSTCPLCRNTLFDPEFSMDNPIFDFDDPREADEIRVSSKTIEPEQMATEKGVFNVRLGKFRKLTESEEENTGGETS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G014360`
TK1151 ID	TkA03G014360
OH-1004 ID	LXL04_006165
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 77.226 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G014360

Location Chr03:3708986-3711155 (-)

Description Similar to ATL46: RING-H2 finger protein ATL46

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g40250`	RING-H2 finger protein ATL46.	No verified direct reference in this release
`At1g23980`	RING-H2 finger protein ATL47.	No verified direct reference in this release
`At4g30400`	RING-H2 finger protein ATL13.	No verified direct reference in this release
`At2g18650`	May be involved in female gametophyte development.	No verified direct reference in this release
`At3g48030`	RING-H2 finger protein ATL48.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006165 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0005634 nucleus Cellular Component

GO:0016020 membrane Cellular Component

GO:0008270 zinc ion binding Molecular Function

GO:0061630 ubiquitin protein ligase activity Molecular Function

KEGG gene cross-reference

ath:AT1G23980

ath:AT2G18650

ath:AT3G48030

ath:AT5G40250

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.338

Rank 1 · TkA03G014360 · TK1151

Nucleus0.282

Rank 2 · TkA03G014360 · TK1151

Cytoplasm0.238

Rank 3 · TkA03G014360 · TK1151

Endoplasmic reticulum0.193

Rank 4 · TkA03G014360 · TK1151

Lysosome / Vacuole0.105

Rank 5 · TkA03G014360 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04893Yip149-94 aa

PF13813MBOAT_266-95 aa

PF16374CIF136-173 aa

PF23413zf_RING_Vps8_fungal146-153 aa

PF12861zf-ANAPC11147-195 aa

PF11793FANCL_C148-188 aa

PF13639zf-RING_2149-192 aa

PF17123zf-RING_11149-178 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G014360	`PF04893`	Yip1	49	94	0.047	14.3
TkA03G014360	`PF13813`	MBOAT_2	66	95	0.029	15.3
TkA03G014360	`PF16374`	CIF	136	173	0.17	12.7
TkA03G014360	`PF23413`	zf_RING_Vps8_fungal	146	153	0.52	10.3
TkA03G014360	`PF12861`	zf-ANAPC11	147	195	4.7e-06	27.3
TkA03G014360	`PF11793`	FANCL_C	148	188	0.31	12.1
TkA03G014360	`PF13639`	zf-RING_2	149	192	4.3e-14	53.2
TkA03G014360	`PF17123`	zf-RING_11	149	178	1.2e-09	38.4
TkA03G014360	`PF12678`	zf-rbx1	149	192	3.1e-09	37.6
TkA03G014360	`PF13920`	zf-C3HC4_3	149	193	0.14	12.6
TkA03G014360	`PF14446`	Prok-RING_1	149	178	1.7	9.5
TkA03G014360	`PF21202`	SLX1_C	149	193	2.1	9.5
TkA03G014360	`PF00097`	zf-C3HC4	150	191	4.5e-06	27.2
TkA03G014360	`PF14634`	zf-RING_5	150	192	1.1e-05	26.0
TkA03G014360	`PF13923`	zf-C3HC4_2	150	191	2.6e-05	24.6
TkA03G014360	`PF13445`	zf-RING_UBOX	150	189	0.00015	22.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FL07`	Arabidopsis thaliana	sp\|Q9FL07\|ATL46_ARATH RING-H2 finger protein ATL46	59.000%	Swiss-Prot	High
`Q8GW38`	Arabidopsis thaliana	sp\|Q8GW38\|ATL47_ARATH RING-H2 finger protein ATL47	53.400%	Swiss-Prot	Medium
`Q940Q4`	Arabidopsis thaliana	sp\|Q940Q4\|ATL13_ARATH RING-H2 finger protein ATL13	41.800%	Swiss-Prot	Medium
`Q9ZV53`	Arabidopsis thaliana	sp\|Q9ZV53\|ATL49_ARATH Putative RING-H2 finger protein ATL49	40.900%	Swiss-Prot	Medium
`Q7X843`	Arabidopsis thaliana	sp\|Q7X843\|ATL48_ARATH RING-H2 finger protein ATL48	45.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card