TkA03G010580 | RubberDandelionOmics

Gene overview

TkA03G010580

Reference: TK1151 Chr: Chr03 Coordinates: 2678022-2681035 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1291 bp · TkA03G010580|TK1151|cDNA

ACTTTCTTCCTCGTTGATTCTGGTTACTGATGGCTGAAGTGATTCAGAGGGAGCAGCAACAGCTGAATCTAGTCATTAGAAAAGCATGTTTTAGTCTGCCAACAGCTTGCCCTTCGTGCTTGCCTGTCTACATCTATCTCAAATTCGCAAATGTTCCTTTCGATTCGTGTTACAATCTCACTTACCCTGATTCCGATCAAATTCCTTACGTTGACTCCGATACATACGTCGCTTACAACAATGAGAAAGGTGGTGTAATT...

CDS

Download CDS FASTA

981 bp · TkA03G010580|TK1151|CDS

ATGGCTGAAGTGATTCAGAGGGAGCAGCAACAGCTGAATCTAGTCATTAGAAAAGCATGTTTTAGTCTGCCAACAGCTTGCCCTTCGTGCTTGCCTGTCTACATCTATCTCAAATTCGCAAATGTTCCTTTCGATTCGTGTTACAATCTCACTTACCCTGATTCCGATCAAATTCCTTACGTTGACTCCGATACATACGTCGCTTACAACAATGAGAAAGGTGGTGTAATTGAAAGTTTGAAACAAGATAATATCGCTAA...

Protein

Download Protein FASTA

326 aa · TkA03G010580|TK1151|PROTEIN

MAEVIQREQQQLNLVIRKACFSLPTACPSCLPVYIYLKFANVPFDSCYNLTYPDSDQIPYVDSDTYVAYNNEKGGVIESLKQDNIANLDSEVQTLPEWVSTIAMINSWLSDAMLYELWIGSDGSSANKIYYSDLPWPIGKLLYLKQVHNVKQLLGISKETAERREEEIYRRATIAYQALSTKLGEESFFFDNRPSSLDAIFLGHALITLYALPETSVLRGKLLEQPFLVIYADKHKAQLLDSESSASSSSSSSSTSVPRR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G010580`
TK1151 ID	TkA03G010580
OH-1004 ID	LXL04_006133
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	95.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G010580

Location Chr03:2678022-2681035 (-)

Description Similar to MTX1: Mitochondrial outer membrane import complex protein METAXIN

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g19080`	Involved in transport of proteins into the mitochondrion.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006133 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006626 protein targeting to mitochondrion Biological Process

GO:0006839 mitochondrial transport Biological Process

GO:0007007 inner mitochondrial membrane organization Biological Process

GO:0015031 protein transport Biological Process

GO:0045040 protein insertion into mitochondrial outer membrane Biological Process

GO:0070096 mitochondrial outer membrane translocase complex assembly Biological Process

GO:0001401 SAM complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005741 mitochondrial outer membrane Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0140275 MIB complex Cellular Component

KEGG gene cross-reference

ath:AT2G19080

hsa:10651

ssc:733591

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.407

Rank 1 · TkA03G010580 · TK1151

Endoplasmic reticulum0.216

Rank 2 · TkA03G010580 · TK1151

Cytoplasm0.182

Rank 3 · TkA03G010580 · TK1151

Nucleus0.128

Rank 4 · TkA03G010580 · TK1151

Peroxisome0.100

Rank 5 · TkA03G010580 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17172GST_N_428-121 aa

PF10568Tom3730-139 aa

PF08628Nexin_C75-181 aa

PF17171GST_C_6175-233 aa

PF04637Herpes_pp85230-268 aa

PF10500SR-25241-287 aa

PF08628Nexin_C263-298 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G010580	`PF17172`	GST_N_4	28	121	1.9e-16	61.2
TkA03G010580	`PF10568`	Tom37	30	139	0.0018	19.3
TkA03G010580	`PF08628`	Nexin_C	75	181	0.096	13.8
TkA03G010580	`PF17171`	GST_C_6	175	233	5.3e-13	49.2
TkA03G010580	`PF04637`	Herpes_pp85	230	268	5.0	6.0
TkA03G010580	`PF10500`	SR-25	241	287	1.7	8.9
TkA03G010580	`PF08628`	Nexin_C	263	298	0.096	13.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O64471`	Arabidopsis thaliana	sp\|O64471\|MTX_ARATH Mitochondrial outer membrane import complex protein METAXIN	53.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card