TkA03G008120 | RubberDandelionOmics

Gene overview

TkA03G008120

Reference: TK1151 Chr: Chr03 Coordinates: 1990883-1992969 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1985 bp · TkA03G008120|TK1151|cDNA

TTCTCACTCCCTAATTTTTAAGCCAAAAAGAAACAATCCCTAAAAATGCCAAAATACGACACAGCGCAAATATGTGTGTGCGCGCCTGGCACCATCATTCAACCCGATTAACCACTCTCTCTCTCTTTACATCCGCCATTGAAGAAGCTTACGATTGCTGACAACATTCATCACTCGACGATCGGGAAATGACCTTTAGAGAAGGGGATAAATCTTTTCACATTGTTTGATTTCTGATGAATCGATCTCAAAACCCATAG...

CDS

Download CDS FASTA

1383 bp · TkA03G008120|TK1151|CDS

ATGCCTAGCGTTGCTGTGAAATTATACAGCGTGTTATTTAAATTGATATTGAAGCGACGGTTACAGAATCGAATCCAGAACCCTAATTTAAACGATGAGGTGAATAGCTCGTTTGGCGTTACGTCGCGTTCTGAAGAGACGATCGTGGCTGCGAATCCTGTGTTTACCGACGGCGTTGCTACCAAAGACATCCATATAGATCCTTCTTCATGTCTCTCAATCCGTATCTTTCTTCCCGACACGTGTCTCTTCGTGTCAGA...

Protein

Download Protein FASTA

460 aa · TkA03G008120|TK1151|PROTEIN

MPSVAVKLYSVLFKLILKRRLQNRIQNPNLNDEVNSSFGVTSRSEETIVAANPVFTDGVATKDIHIDPSSCLSIRIFLPDTCLFVSDSAADRVRQKRSELESRSFPSNSENGIPRRNSYGSVDTNSVSATPSNRRSSYCNGFSKDDLNLKSENGAYRGYSPFTHRSRKLPLMVQFHGGGFVAGSCDSSANDFFCRRIAKMCDVIVVAVGYRLAPENRYPAAFEDGVKVLHWLAKQANLAECGKSLGRSPDSRKADVQGHI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G008120`
TK1151 ID	TkA03G008120
OH-1004 ID	LXL04_025784
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	56.700
Protein coverage (%)	TK1151 96.957 / OH-1004 60.095 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G008120

Location Chr03:1990883-1992969 (+)

Description Similar to CXE16: Probable carboxylesterase 16

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g14310`	Carboxylesterase acting on esters with varying acyl chain length.	No verified direct reference in this release
`At3g27320`	Carboxylesterase acting on esters with varying acyl chain length.	No verified direct reference in this release
`At5g62180`	Carboxylesterase that possesses esterase activity in vitro with the synthetic substrate p-nitrophenyl acetate (pNPA).	Arabidopsis Carboxylesterase 20 Binds Strigolactone and Increases Branches and Tillers When Ectopically Expressed in Arabidopsis and Maize.2021 · DOI: 10.3389/fpls.2021.639401 Structural insights into strigolactone catabolism by carboxylesterases reveal a conserved conformational regulation.2024 · DOI: 10.1038/s41467-024-50928-3

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025784 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009739 response to gibberellin Biological Process

GO:0009939 positive regulation of gibberellic acid mediated signaling pathway Biological Process

GO:0010476 gibberellin mediated signaling pathway Biological Process

GO:0010629 negative regulation of gene expression Biological Process

GO:0048444 floral organ morphogenesis Biological Process

GO:0048530 fruit morphogenesis Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:1905516 positive regulation of fertilization Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0010331 gibberellin binding Molecular Function

KEGG gene cross-reference

ath:AT3G05120

ath:AT3G27320

ath:AT3G63010

ath:AT5G14310

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.405

Rank 1 · TkA03G008120 · TK1151

Nucleus0.385

Rank 2 · TkA03G008120 · TK1151

Cell membrane0.099

Rank 3 · TkA03G008120 · TK1151

Plastid0.082

Rank 4 · TkA03G008120 · TK1151

Mitochondrion0.068

Rank 5 · TkA03G008120 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23771DUF71683-24 aa

PF23771DUF7168129-142 aa

PF00135COesterase163-213 aa

PF20434BD-FAE164-237 aa

PF07859Abhydrolase_3172-425 aa

PF23771DUF7168256-297 aa

PF20434BD-FAE277-299 aa

PF00135COesterase277-300 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G008120	`PF23771`	DUF7168	3	24	0.18	12.2
TkA03G008120	`PF23771`	DUF7168	129	142	0.18	12.2
TkA03G008120	`PF00135`	COesterase	163	213	9.3e-08	32.2
TkA03G008120	`PF20434`	BD-FAE	164	237	1.6e-08	35.0
TkA03G008120	`PF07859`	Abhydrolase_3	172	425	1.3e-58	198.9
TkA03G008120	`PF23771`	DUF7168	256	297	0.18	12.2
TkA03G008120	`PF20434`	BD-FAE	277	299	1.6e-08	35.0
TkA03G008120	`PF00135`	COesterase	277	300	9.3e-08	32.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LED9`	Arabidopsis thaliana	sp\|Q8LED9\|CXE16_ARATH Probable carboxylesterase 16	66.900%	Swiss-Prot	High
`Q9LK21`	Arabidopsis thaliana	sp\|Q9LK21\|CXE11_ARATH Probable carboxylesterase 11	64.300%	Swiss-Prot	High
`Q9LVB8`	Arabidopsis thaliana	sp\|Q9LVB8\|CXE20_ARATH Carboxylesterase 20	33.700%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card