TkA02G609460 | RubberDandelionOmics

Gene overview

TkA02G609460

Reference: TK1151 Chr: Chr02 Coordinates: 157194164-157196658 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1446 bp · TkA02G609460|TK1151|cDNA

TAAACACCCCGGCCCCCTCCCTCTGCTTACCTGTATATATACAAAGATAATTGGTATACTTCAAATCTCCCCGATTTAAGTTAGCTTAATTAACAGAAGATGGTGCTGGTAGGCATAGCAGCTAAGATTTACGAGGCAATGGGTATTCAAAGGTGGCTACCTATAATGTCCAATTCCGAATCCATGTCCAAATCCAGACATGATCACATGGATCGTGCTTACATTAATACCCCCGCTGGCGAACCTAATTCTATGGTCGA...

CDS

Download CDS FASTA

1041 bp · TkA02G609460|TK1151|CDS

ATGGTGCTGGTAGGCATAGCAGCTAAGATTTACGAGGCAATGGGTATTCAAAGGTGGCTACCTATAATGTCCAATTCCGAATCCATGTCCAAATCCAGACATGATCACATGGATCGTGCTTACATTAATACCCCCGCTGGCGAACCTAATTCTATGGTCGATGAAACCTATATATCTTGGTTGAAAGAACACCCATCTGCTATAAGCTCCTTCCAGCGGATGATAAACGCATCAAAAGGAAAGCAGATAGCCGTGTTCTT...

Protein

Download Protein FASTA

346 aa · TkA02G609460|TK1151|PROTEIN

MVLVGIAAKIYEAMGIQRWLPIMSNSESMSKSRHDHMDRAYINTPAGEPNSMVDETYISWLKEHPSAISSFQRMINASKGKQIAVFLDYDGTLSPIVCDPNRAFMSDQMRAAVGEVSKHFPTAIISGRSREKVHSFVKLNEVYYSGSHGMDTMGPARKNKSYDDTYHYKTTDDEGNEFIVFQPAKDFLPAIEKMLIEMRERTSEIKGVVIEDNRFCMSVHYRHVKDEEEYARLEEEVESVLVNYPEFHMTRGKKVLEIRP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G609460`
TK1151 ID	TkA02G609460
OH-1004 ID	LXL04_021610
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	70.800
Protein coverage (%)	TK1151 97.688 / OH-1004 96.389 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G609460

Location Chr02:157194164-157196658 (-)

Description Similar to TPP7: Probable trehalose-phosphate phosphatase 7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g22590`	Removes the phosphate from trehalose 6-phosphate to produce free trehalose.	No verified direct reference in this release
`At1g78090`	Removes the phosphate from trehalose 6-phosphate to produce free trehalose.	Trehalose-6-phosphate phosphatases from Arabidopsis thaliana: identification by functional complementation of the yeast tps2 mutant.1998 · DOI: 10.1046/j.1365-313x.1998.00064.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os10g0553300`	Removes the phosphate from trehalose 6-phosphate to produce free trehalose.	No verified direct reference in this release
`Os08g0409100`	Removes the phosphate from trehalose 6-phosphate to produce free trehalose.	No verified direct reference in this release
`Os09g0369400`	Removes the phosphate from trehalose 6-phosphate to produce free trehalose.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021610 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005992 trehalose biosynthetic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0004805 trehalose-phosphatase activity Molecular Function

KEGG gene cross-reference

ath:AT1G78090

dosa:Os07g0624600

dosa:Os08g0409100

dosa:Os09g0369400

dosa:Os10g0553300

osa:4349333

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.555

Rank 1 · TkA02G609460 · TK1151

Nucleus0.391

Rank 2 · TkA02G609460 · TK1151

Cell membrane0.089

Rank 3 · TkA02G609460 · TK1151

Plastid0.072

Rank 4 · TkA02G609460 · TK1151

Mitochondrion0.059

Rank 5 · TkA02G609460 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08282Hydrolase_385-299 aa

PF02358Trehalose_PPase86-327 aa

PF02920Integrase_DNA163-206 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G609460	`PF08282`	Hydrolase_3	85	299	1.4e-06	29.0
TkA02G609460	`PF02358`	Trehalose_PPase	86	327	4.3e-58	196.9
TkA02G609460	`PF02920`	Integrase_DNA	163	206	0.049	14.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SUW0`	Arabidopsis thaliana	sp\|Q9SUW0\|TPPG_ARATH Probable trehalose-phosphate phosphatase G	56.600%	Swiss-Prot	High
`Q9C9S4`	Arabidopsis thaliana	sp\|Q9C9S4\|TPPB_ARATH Trehalose-phosphate phosphatase B	53.700%	Swiss-Prot	High
`Q9FWQ2`	Oryza sativa subsp. japonica	sp\|Q9FWQ2\|TPP2_ORYSJ Probable trehalose-phosphate phosphatase 2	52.700%	Swiss-Prot	High
`Q6ZAL2`	Oryza sativa subsp. japonica	sp\|Q6ZAL2\|TPP6_ORYSJ Probable trehalose-phosphate phosphatase 6	51.100%	Swiss-Prot	High
`Q6H5L4`	Oryza sativa subsp. japonica	sp\|Q6H5L4\|TPP7_ORYSJ Probable trehalose-phosphate phosphatase 7	52.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card