TkA02G597880 | RubberDandelionOmics

Gene overview

TkA02G597880

Reference: TK1151 Chr: Chr02 Coordinates: 154150750-154153140 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1696 bp · TkA02G597880|TK1151|cDNA

CTGGGTATTACCAATTCAATTTTTACTCATTCACTTATTATACTGACTCATTCAAACCTTCGTTTCATTTTAATCTATCACCACAACGCCGCCTCCATCCTCCAGTCACTACATTTGGATCTCTGAAATCCAGCAGGCGTCGCAATGAGAGCTAAGTGGAAGAAGAAGAGAATGAGGAGGTTGAAGAGGAAGCATCGAAAGATGAGACAGAGATCCAATTAGATGAATGAAAGCTTCAACTCGGAATCGTCTCCGTTGCT...

CDS

Download CDS FASTA

714 bp · TkA02G597880|TK1151|CDS

ATGATGGGGACCTTGTTTCATGTGGAACTGGGTAATGCTATTTACAGGTTTAGTTTTATTTCCATTGTGTTTTTACTTTGTGGGTTTGACCCTGTTCGATCAAAAGAACTTGAAGAGAAGATATCATCAATTGGTGCTTTTGTGAGTAATACATGGAGCCCAAAGTGCACACATGTGGTTCTTGGTGATAATGCGTCAGTATATAGTGATCTAATTGATGCCATAATGTCCAAAATACATTTTGTCAGTTACAAATGGAT...

Protein

Download Protein FASTA

237 aa · TkA02G597880|TK1151|PROTEIN

MMGTLFHVELGNAIYRFSFISIVFLLCGFDPVRSKELEEKISSIGAFVSNTWSPKCTHVVLGDNASVYSDLIDAIMSKIHFVSYKWIESLADKRIGTKIPSCGSDASSLMLEGVSVKICDTESRDNCLSGHTFLPESSQKYKVKQKLQALLETFGAKVLPIEDFIPQSQGFEEDENNHVVHVISVDNSECIRNLTSIPNVTELNLICATLSGPVLGASNPTNKWGTRYDSKITYNCI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G597880`
TK1151 ID	TkA02G597880
OH-1004 ID	LXL04_015618
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	77.100
Protein coverage (%)	TK1151 89.873 / OH-1004 73.214 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G597880`
Location	Chr02:154150750-154153140 (-)
Description	Similar to NBS1: Nijmegen breakage syndrome 1 protein
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_015618` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000724 double-strand break repair via homologous recombination Biological Process GO:0006312 mitotic recombination Biological Process GO:0006974 DNA damage response Biological Process GO:0007095 mitotic G2 DNA damage checkpoint signaling Biological Process GO:0007131 reciprocal meiotic recombination Biological Process GO:0071479 cellular response to ionizing radiation Biological Process GO:0005634 nucleus Cellular Component GO:0005694 chromosome Cellular Component GO:0030870 Mre11 complex Cellular Component GO:0003684 damaged DNA binding Molecular Function
KEGG gene cross-reference	ath:AT3G02680 dosa:Os10g0487300 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.690

Rank 1 · TkA02G597880 · TK1151

Cytoplasm0.368

Rank 2 · TkA02G597880 · TK1151

Mitochondrion0.043

Rank 3 · TkA02G597880 · TK1151

Cell membrane0.036

Rank 4 · TkA02G597880 · TK1151

Endoplasmic reticulum0.023

Rank 5 · TkA02G597880 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00533BRCT22-88 aa

PF16589BRCT_224-88 aa

PF12738PTCB-BRCT26-63 aa

PF00533BRCT125-186 aa

PF16589BRCT_2133-188 aa

PF12738PTCB-BRCT144-158 aa

PF12738PTCB-BRCT176-183 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G597880	`PF00533`	BRCT	22	88	3.2e-14	53.6
TkA02G597880	`PF16589`	BRCT_2	24	88	0.0032	18.5
TkA02G597880	`PF12738`	PTCB-BRCT	26	63	7.9e-05	23.3
TkA02G597880	`PF00533`	BRCT	125	186	3.2e-14	53.6
TkA02G597880	`PF16589`	BRCT_2	133	188	0.0032	18.5
TkA02G597880	`PF12738`	PTCB-BRCT	144	158	7.9e-05	23.3
TkA02G597880	`PF12738`	PTCB-BRCT	176	183	7.9e-05	23.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card