TkA02G595010 | RubberDandelionOmics

Gene overview

TkA02G595010

Reference: TK1151 Chr: Chr02 Coordinates: 153528659-153530206 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1335 bp · TkA02G595010|TK1151|cDNA

ATGGTGCTTGTTTACGAGCTTATGACTAACGGAAGCTTACAAGATTGCTTGCTTCATCGCAAGTCTCCGGAGCTTAAGGAGTGGAAAAAGCGGCTTTCGGTTGCAATTGATGTTGACGAATGTCGAATTGACTTGAATAATAAGATTGAGGAAGGGAAAAATATAGGAAGTTCAATAATAGAGGATAGCGGATCTGTCTTCGAGGAGACTGAGAGTCTGGCAACGACGACAGTCTGTGAAGAGTTCACTCCCATAGCCGA...

CDS

Download CDS FASTA

1335 bp · TkA02G595010|TK1151|CDS

ATGGTGCTTGTTTACGAGCTTATGACTAACGGAAGCTTACAAGATTGCTTGCTTCATCGCAAGTCTCCGGAGCTTAAGGAGTGGAAAAAGCGGCTTTCGGTTGCAATTGATGTTGACGAATGTCGAATTGACTTGAATAATAAGATTGAGGAAGGGAAAAATATAGGAAGTTCAATAATAGAGGATAGCGGATCTGTCTTCGAGGAGACTGAGAGTCTGGCAACGACGACAGTCTGTGAAGAGTTCACTCCCATAGCCGA...

Protein

Download Protein FASTA

444 aa · TkA02G595010|TK1151|PROTEIN

MVLVYELMTNGSLQDCLLHRKSPELKEWKKRLSVAIDVDECRIDLNNKIEEGKNIGSSIIEDSGSVFEETESLATTTVCEEFTPIAETSPETFIQSPRTVPAGDVSLSEGNLDTISLESGGASLQKSRTRKKSMSGKDWWWKQDNSMSESGRVKDYVMEWIGSEIKKERPKTEWITAGASSSAATQTSKSSKKKNDKTIKKQKRRPAREWWKEEYCEELAKKKKKNMKKQRKESVNNDIYSNDDELYMERKKKRTRSRSR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G595010`
TK1151 ID	TkA02G595010
OH-1004 ID	LXL04_011989
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	85.600
Protein coverage (%)	TK1151 100.000 / OH-1004 78.030 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G595010

Location Chr02:153528659-153530206 (+)

Description Similar to At4g25390: Receptor-like serine/threonine-protein kinase At4g25390

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g25390`	Receptor-like serine/threonine-protein kinase At4g25390.	No verified direct reference in this release
`At2g45590`	Receptor-like serine/threonine-protein kinase At2g45590.	No verified direct reference in this release
`At1g80870`	Putative receptor-like protein kinase At1g80870.	No verified direct reference in this release
`At1g29720`	Probable LRR receptor-like serine/threonine-protein kinase At1g29720.	No verified direct reference in this release
`At1g56140`	Probable LRR receptor-like serine/threonine-protein kinase At1g56140.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011989 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0106310 protein serine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G49270

ath:AT1G80870

ath:AT2G45590

ath:AT4G25390

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.547

Rank 1 · TkA02G595010 · TK1151

Nucleus0.306

Rank 2 · TkA02G595010 · TK1151

Cytoplasm0.292

Rank 3 · TkA02G595010 · TK1151

Endoplasmic reticulum0.052

Rank 4 · TkA02G595010 · TK1151

Golgi apparatus0.039

Rank 5 · TkA02G595010 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase1-27 aa

PF07714PK_Tyr_Ser-Thr2-36 aa

PF00069Pkinase212-219 aa

PF00069Pkinase301-414 aa

PF07714PK_Tyr_Ser-Thr302-415 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G595010	`PF00069`	Pkinase	1	27	2.6e-08	34.3
TkA02G595010	`PF07714`	PK_Tyr_Ser-Thr	2	36	2.9e-07	30.8
TkA02G595010	`PF00069`	Pkinase	212	219	2.6e-08	34.3
TkA02G595010	`PF00069`	Pkinase	301	414	2.6e-08	34.3
TkA02G595010	`PF07714`	PK_Tyr_Ser-Thr	302	415	2.9e-07	30.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9STJ8`	Arabidopsis thaliana	sp\|Q9STJ8\|Y4539_ARATH Receptor-like serine/threonine-protein kinase At4g25390	51.500%	Swiss-Prot	High
`O64639`	Arabidopsis thaliana	sp\|O64639\|Y2559_ARATH Receptor-like serine/threonine-protein kinase At2g45590	45.900%	Swiss-Prot	Medium
`Q9SAH3`	Arabidopsis thaliana	sp\|Q9SAH3\|Y1887_ARATH Putative receptor-like protein kinase At1g80870	50.300%	Swiss-Prot	Low
`Q9ASQ6`	Arabidopsis thaliana	sp\|Q9ASQ6\|Y1972_ARATH Probable LRR receptor-like serine/threonine-protein kinase At1g29720	40.300%	Swiss-Prot	Low
`C0LGH3`	Arabidopsis thaliana	sp\|C0LGH3\|Y5614_ARATH Probable LRR receptor-like serine/threonine-protein kinase At1g56140	42.400%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card