TkA02G586380 | RubberDandelionOmics

Gene overview

TkA02G586380

Reference: TK1151 Chr: Chr02 Coordinates: 151286479-151288650 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1645 bp · TkA02G586380|TK1151|cDNA

GCGGACATTCGCCTCGTTTAGAAATAAAAATAGCTAATTTCTATTGTGGGGTGACTGTGGTCCTCATACTTAATAGCCATTGAAATTAAGCGATTCTCCCCACCAACCTCCTCCATGAAATCCAAGTGGGCTTTTGTTCATGTGGTTTAGACCATGGAAGAAATAAATTCAGGAATCAGGATGCACTTGTTGGGTGGGTAAACATAACCTTCAGCCGTCAATGCCCTTGATTCATTGATTAATATACCTCAATTTGGAAT...

CDS

Download CDS FASTA

1065 bp · TkA02G586380|TK1151|CDS

ATGATGAACACACAAAGTATAATAGAGGAAGATGAAGTCATAATAGGTCAGGCACAAATTTGGCGATACCTATACGCAGCTTTTGACGCCATGGCCATACGATGTTGTGTTGAGCTCCGTATTGCTGATATAATAAGCAATCAAAATCGCCCAACATTATTGTCAGAAATCGCAGCTCAAATCGACTCTTCGTCAATCAATGTCGACGGACTTGGACGACTCATGAAGTTCTTGGTCCACAAAAAGGTCTTCAGTCAGAC...

Protein

Download Protein FASTA

354 aa · TkA02G586380|TK1151|PROTEIN

MMNTQSIIEEDEVIIGQAQIWRYLYAAFDAMAIRCCVELRIADIISNQNRPTLLSEIAAQIDSSSINVDGLGRLMKFLVHKKVFSQTEEDGETLYAMNNCSKWLLSDTNLMTLAPFVMMCTNPLLVSPLHILSRSIKEGGTTFKMTHGEEMYSFPKINPEFNTIFNESMTCSSKINIDAIISSYRNGFLGLKGSVVDVGGGTGVTISEIVKAYPHLKGVNFDLAHVISTAPIYDGVTHIAGDMFRVIPPAETIFMKWILH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G586380`
TK1151 ID	TkA02G586380
OH-1004 ID	LXL04_019610
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	36.100
Protein coverage (%)	TK1151 99.718 / OH-1004 98.870 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G586380`
Location	Chr02:151286479-151288650 (-)
Description	Similar to ASMT: Acetylserotonin O-methyltransferase
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_019610` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006970 response to osmotic stress Biological Process GO:0007623 circadian rhythm Biological Process GO:0010187 negative regulation of seed germination Biological Process GO:0010555 response to mannitol Biological Process GO:0030187 melatonin biosynthetic process Biological Process GO:0032259 methylation Biological Process GO:0050832 defense response to fungus Biological Process GO:0090333 regulation of stomatal closure Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0008171 O-methyltransferase activity Molecular Function
KEGG gene cross-reference	ath:AT4G35160 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.850

Rank 1 · TkA02G586380 · TK1151

Nucleus0.297

Rank 2 · TkA02G586380 · TK1151

Endoplasmic reticulum0.043

Rank 3 · TkA02G586380 · TK1151

Mitochondrion0.039

Rank 4 · TkA02G586380 · TK1151

Peroxisome0.038

Rank 5 · TkA02G586380 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08100Dimerisation21-107 aa

PF00891Methyltransf_2132-335 aa

PF13489Methyltransf_23191-225 aa

PF13649Methyltransf_25195-278 aa

PF05891Methyltransf_PK252-305 aa

PF13649Methyltransf_25289-313 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G586380	`PF08100`	Dimerisation	21	107	1.6e-15	57.5
TkA02G586380	`PF00891`	Methyltransf_2	132	335	5e-53	180.3
TkA02G586380	`PF13489`	Methyltransf_23	191	225	0.17	12.3
TkA02G586380	`PF13649`	Methyltransf_25	195	278	0.017	16.5
TkA02G586380	`PF05891`	Methyltransf_PK	252	305	0.093	13.0
TkA02G586380	`PF13649`	Methyltransf_25	289	313	0.017	16.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card