TkA02G584470 | RubberDandelionOmics

Gene overview

TkA02G584470

Reference: TK1151 Chr: Chr02 Coordinates: 150816587-150823424 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

741 bp · TkA02G584470|TK1151|cDNA

ATGAAGCTTAATCAAGCTTGGAACTCGCGACCTGCCCTAGCGACTCCCGATTCCCGAACGGTGAACTTTCGCTTGTATCTCGGTCCAATCAAGCTTTTCCGTCGATCTGTGGACTTCTACCGAGGTATTATCTTCTACAGTTTTGGATCAAGTTGGCAGTTTTGTATCAATATTGGTTCAAATATGGTTCTGATTCAAATTTCTACTGCTGATGTATCTATTTCACAGGGCCTTGGAAAGACGGTTTCTGTTATTGCACT...

CDS

Download CDS FASTA

741 bp · TkA02G584470|TK1151|CDS

ATGAAGCTTAATCAAGCTTGGAACTCGCGACCTGCCCTAGCGACTCCCGATTCCCGAACGGTGAACTTTCGCTTGTATCTCGGTCCAATCAAGCTTTTCCGTCGATCTGTGGACTTCTACCGAGGTATTATCTTCTACAGTTTTGGATCAAGTTGGCAGTTTTGTATCAATATTGGTTCAAATATGGTTCTGATTCAAATTTCTACTGCTGATGTATCTATTTCACAGGGCCTTGGAAAGACGGTTTCTGTTATTGCACT...

Protein

Download Protein FASTA

246 aa · TkA02G584470|TK1151|PROTEIN

MKLNQAWNSRPALATPDSRTVNFRLYLGPIKLFRRSVDFYRGIIFYSFGSSWQFCINIGSNMVLIQISTADVSISQGLGKTVSVIALIQMQKFLLTQKSVDLDNDNDKESALPASADISRLTPCKDSKQFAKRETKSLKKLESSLKLYAPDSAPTLAIKATIEKTKRRKNTNLVVEASPRNAREVMEFDLEKLVSKEEHLFSTCTQKVKYRKPRYETLEKDQKFWLKREERTLALERKSGAKFLGA

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G584470`
TK1151 ID	TkA02G584470
OH-1004 ID	LXL04_038417
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	97.500
Protein coverage (%)	TK1151 32.114 / OH-1004 31.225 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G584470

Location Chr02:150816587-150823424 (+)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g31330`	Participates in efficiency of electron transfer from plastocyanin to P700 (or cytochrome c553 in algae and cyanobacteria).	Down-regulation of the PSI-F subunit of photosystem I (PSI) in Arabidopsis thaliana. The PSI-F subunit is essential for photoautotrophic growth and contributes to antenna function.2000 · DOI: 10.1074/jbc.m002933200

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038417 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source) No functional description available

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.452

Rank 1 · TkA02G584470 · TK1151

Cytoplasm0.319

Rank 2 · TkA02G584470 · TK1151

Cell membrane0.096

Rank 3 · TkA02G584470 · TK1151

Mitochondrion0.089

Rank 4 · TkA02G584470 · TK1151

Plastid0.085

Rank 5 · TkA02G584470 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29222DUF851696-146 aa

PF02507PSI_PsaF111-169 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G584470	`PF29222`	DUF8516	96	146	0.012	16.6
TkA02G584470	`PF02507`	PSI_PsaF	111	169	5.2e-17	62.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SHE8`	Arabidopsis thaliana	sp\|Q9SHE8\|PSAF_ARATH Photosystem I reaction center subunit III, chloroplastic	78.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card