RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA02G573310
Reference: TK1151 Chr: Chr02 Coordinates: 148069052-148070411 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

801 bp · TkA02G573310|TK1151|cDNA

GTACTATTACATGTTGACCAGTCACGCAATTGCTTGACTACTTGTGTCTCCCATTCCCTTCCCCAATTCCTTCCGGAATCAAATTCCGGCGAGACATACAGTAATTGTTGTCTTCATAGTGGTGTGTGTGAAATGAAGAAGAAGAGAGCAGGATCAGCACTGAAGACACAAGTGGAAGAAAAGAAGCTTAAAGTAACAGTTAAACATGAGACATCTGAGGATGAAGAATCAGAAAGTGAAGAAGAAGAAACACAAGTAGT...

CDS

Download CDS FASTA

801 bp · TkA02G573310|TK1151|CDS

GTACTATTACATGTTGACCAGTCACGCAATTGCTTGACTACTTGTGTCTCCCATTCCCTTCCCCAATTCCTTCCGGAATCAAATTCCGGCGAGACATACAGTAATTGTTGTCTTCATAGTGGTGTGTGTGAAATGAAGAAGAAGAGAGCAGGATCAGCACTGAAGACACAAGTGGAAGAAAAGAAGCTTAAAGTAACAGTTAAACATGAGACATCTGAGGATGAAGAATCAGAAAGTGAAGAAGAAGAAACACAAGTAGT...

Protein

Download Protein FASTA

267 aa · TkA02G573310|TK1151|PROTEIN

VLLHVDQSRNCLTTCVSHSLPQFLPESNSGETYSNCCLHSGVCEMKKKRAGSALKTQVEEKKLKVTVKHETSEDEESESEEEETQVVEEEVEEEEEEEKKEEEEEEVEEEEEEEEEEEEEEDEEDDDESCKKETLKKLLEPLPKDKIIEFLKEAALNDASILSTLTQIAEVDPAHRKIFVYGLGWDATSDQVLSVFKPFGQIEECKVVIDKITGKAKGYGFVLFKSRKSAQKSLKQTQKKIGSRIASCQLASAGPGGPPP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA02G573310
TK1151 IDTkA02G573310
OH-1004 IDLXL04_012289
Relationship / confidenceNon Reciprocal Best Hit / Complex relationship
Protein identity (%)88.300
Protein coverage (%)TK1151 99.251 / OH-1004 35.270
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA02G573310
LocationChr02:148069052-148070411 (+)
DescriptionSimilar to UBA2B: UBP1-associated protein 2B
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g56860 Heterogeneous nuclear ribonucleoprotein (hnRNP)-like protein that acts as a component of a complex regulating the turnover of mRNAs in the nucleus.
UBA1 and UBA2, two proteins that interact with UBP1, a multifunctional effector of pre-mRNA maturation in plants.2002 · DOI: 10.1128/mcb.22.12.4346-4357.2002
At2g41060 Heterogeneous nuclear ribonucleoprotein (hnRNP)-like protein that acts as a component of a complex regulating the turnover of mRNAs in the nucleus. No verified direct reference in this release
At2g22090 Acts as a component of a complex regulating the turnover of mRNAs in the nucleus.
UBA1 and UBA2, two proteins that interact with UBP1, a multifunctional effector of pre-mRNA maturation in plants.2002 · DOI: 10.1128/mcb.22.12.4346-4357.2002
At2g19380 May regulate the turnover of mRNAs in the nucleus. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os01g0265800 RNA-binding protein that binds to a cis-localization element or zipcode, within the 5'-CDS of prolamine RNA.
Characterization of RNA binding protein RBP-P reveals a possible role in rice glutelin gene expression and RNA localization.2014 · DOI: 10.1007/s11103-014-0191-z
RNA-Binding Protein RBP-P Is Required for Glutelin and Prolamine mRNA Localization in Rice Endosperm Cells.2018 · DOI: 10.1105/tpc.18.00321
Zipcode RNA-Binding Proteins and Membrane Trafficking Proteins Cooperate to Transport Glutelin mRNAs in Rice Endosperm.2020 · DOI: 10.1105/tpc.20.00111
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_012289 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006952 defense response Biological Process
GO:0009693 ethylene biosynthetic process Biological Process
GO:0009738 abscisic acid-activated signaling pathway Biological Process
GO:0010150 leaf senescence Biological Process
GO:0012501 programmed cell death Biological Process
GO:0048255 mRNA stabilization Biological Process
GO:0051028 mRNA transport Biological Process
GO:0005634 nucleus Cellular Component
GO:0005730 nucleolus Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0003729 mRNA binding Molecular Function
GO:0035925 mRNA 3'-UTR AU-rich region binding Molecular Function
KEGG gene cross-reference
ath:AT2G22090
ath:AT2G41060
ath:AT3G15010
ath:AT3G56860
dosa:Os01g0265800
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.831
Rank 1 · TkA02G573310 · TK1151
Cytoplasm0.244
Rank 2 · TkA02G573310 · TK1151
Mitochondrion0.037
Rank 3 · TkA02G573310 · TK1151
Cell membrane0.033
Rank 4 · TkA02G573310 · TK1151
Endoplasmic reticulum0.022
Rank 5 · TkA02G573310 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05327RRN36-142 aa
PF09184PPP4R228-127 aa
PF06473FGF-BP137-125 aa
PF03985Paf144-133 aa
PF28447Ccdc2744-140 aa
PF10486PI3K_1B_p10144-134 aa
PF08693SKG644-130 aa
PF05793TFIIF_alpha45-139 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA02G573310PF05327RRN361420.002317.3
TkA02G573310PF09184PPP4R2281270.07213.3
TkA02G573310PF06473FGF-BP1371251.69.2
TkA02G573310PF03985Paf1441330.07312.8
TkA02G573310PF28447Ccdc27441401.88.0
TkA02G573310PF10486PI3K_1B_p101441342.66.4
TkA02G573310PF08693SKG6441303.67.0
TkA02G573310PF05793TFIIF_alpha451391.48.1
TkA02G573310PF11705RNA_pol_3_Rpc31461260.02715.2
TkA02G573310PF15273NHS461457.05.2
TkA02G573310PF03286Pox_Ag35471260.2911.9
TkA02G573310PF15396FAM60A471537.07.3
TkA02G573310PF04889Cwf_Cwc_15481330.9210.0
TkA02G573310PF06459RR_TM4-6491290.4211.1
TkA02G573310PF28211GlpR491271.39.7
TkA02G573310PF13086AAA_11501690.4211.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9LES2Arabidopsis thalianasp|Q9LES2|UBA2A_ARATH UBP1-associated protein 2A52.700%Swiss-ProtLow
O80678Arabidopsis thalianasp|O80678|UBA2B_ARATH UBP1-associated protein 2B52.000%Swiss-ProtLow
Q9SHZ6Arabidopsis thalianasp|Q9SHZ6|UBA1A_ARATH UBP1-associated proteins 1A51.200%Swiss-ProtLow
O64571Arabidopsis thalianasp|O64571|UBA1C_ARATH UBP1-associated proteins 1C43.200%Swiss-ProtLow
Q9LJ04Oryza sativa subsp. japonicasp|Q9LJ04|RBPP_ORYSJ RNA-binding protein P48.400%Swiss-ProtLow

JBrowse

View in Genome Browser