TkA02G565690 | RubberDandelionOmics

Gene overview

TkA02G565690

Reference: TK1151 Chr: Chr02 Coordinates: 146044041-146048168 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2362 bp · TkA02G565690|TK1151|cDNA

GTTTCAAAAGCATCCGATCAGAATCGGAAAAAACTCCTCAAACTCTATCGTTCTTCTTCCGCTTTCAATTCTCCGTAATCGCAAGCCAACTCACTCCCGATTCGCTCAAAAAACTTGATCAGAATCCTCAACCCTGTAAAAATTGCAAATTATCAATTTCCCCCATTTTACAACCCTAATTTATCTTATTCCTTACAATCTTGTATACATGGTTACTGATAGCTCCCCAATTTCGACGATGGAGCTGACATATTCTCTCC...

CDS

Download CDS FASTA

1773 bp · TkA02G565690|TK1151|CDS

ATGATGCCAAGTGAAAGTGATTCCATGGTGGTGAAGAGAAAGGAAATGACAGGTCTTGAGCTCGAAGGTAGCAGAAGATCAAAAAAGAAGAAGCAAGGGGGCACACCTCGTCCAGCTTGCTCTTGGGTACATTTTAGCCGTGAGTTCATCAAAGAGTACAGCGCTTCCCATCCCGAATCTTCTGGTCTCAAAGTTGCAACAAGAGCAGCCTCAGATGCTTGGAAAGTCATGACCCTCGAAGAAAAGTCAAAATACACAAA...

Protein

Download Protein FASTA

590 aa · TkA02G565690|TK1151|PROTEIN

MMPSESDSMVVKRKEMTGLELEGSRRSKKKKQGGTPRPACSWVHFSREFIKEYSASHPESSGLKVATRAASDAWKVMTLEEKSKYTKRAREVWDDYLSSAPAREPKPRKQANLVTRCSPGRLVNVLKHFTVDQKEAVKSMGFGSLLDLKCRTLRRSLCLWLLERFNTIRRSLEICGERIPLYPHDVELVMGLPATGKDVVNSGPDDLVTELRQKYNASNRGISVRFLEERLGQPEAGDDFKRAFLLYVLGTLLCPTARLD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G565690`
TK1151 ID	TkA02G565690
OH-1004 ID	LXL04_007012
Relationship / confidence	Rbh High Identity Coverage Local Synteny Minor Chr Pair / Probable
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G565690`
Location	Chr02:146044041-146048168 (-)
Description	No functional description available
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_007012` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0010073 meristem maintenance Biological Process GO:0010082 regulation of root meristem growth Biological Process GO:0016567 protein ubiquitination Biological Process GO:0048507 meristem development Biological Process GO:0005634 nucleus Cellular Component GO:0008270 zinc ion binding Molecular Function GO:0008483 transaminase activity Molecular Function GO:0061630 ubiquitin protein ligase activity Molecular Function
KEGG gene cross-reference	ath:AT1G17930 ath:AT1G66620 ath:AT1G66630 ath:AT2G25010 ath:AT5G37930 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.672

Rank 1 · TkA02G565690 · TK1151

Cytoplasm0.322

Rank 2 · TkA02G565690 · TK1151

Cell membrane0.065

Rank 3 · TkA02G565690 · TK1151

Endoplasmic reticulum0.046

Rank 4 · TkA02G565690 · TK1151

Mitochondrion0.045

Rank 5 · TkA02G565690 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07800DUF164422-81 aa

PF00505HMG_box36-102 aa

PF09011HMG_box_244-96 aa

PF31142KAP_N62-92 aa

PF29561DUF8566115-311 aa

PF09011HMG_box_2154-174 aa

PF10536PMD184-323 aa

PF00505HMG_box210-232 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G565690	`PF07800`	DUF1644	22	81	0.18	12.6
TkA02G565690	`PF00505`	HMG_box	36	102	3.4e-08	34.5
TkA02G565690	`PF09011`	HMG_box_2	44	96	0.00037	21.8
TkA02G565690	`PF31142`	KAP_N	62	92	0.12	13.0
TkA02G565690	`PF29561`	DUF8566	115	311	8.7e-66	222.3
TkA02G565690	`PF09011`	HMG_box_2	154	174	0.00037	21.8
TkA02G565690	`PF10536`	PMD	184	323	3e-11	43.8
TkA02G565690	`PF00505`	HMG_box	210	232	3.4e-08	34.5
TkA02G565690	`PF07800`	DUF1644	439	465	0.18	12.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card