TkA02G558050 | RubberDandelionOmics

Gene overview

TkA02G558050

Reference: TK1151 Chr: Chr02 Coordinates: 144149851-144154596 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2871 bp · TkA02G558050|TK1151|cDNA

ATAAAGAAGAGATCCCCAAAGTTTGCTTTTTCGGATCTGAAGATACCGACGGCCTCCAGCCCCAAACTCGAGTCGCGTGTGAAGAAATCAGCACATGTATACATCCATATACACAGTGCATAACGTCAGACGCTGATTTCGGCTTTTACACGTGATCTCCTCCGCCATGTCTCCACCCTTCTTTCTCTCTCTTATGGAGTTCATCCAACTAGCAACTACAGTAGACTGGCCTCACTCGCAATAGAACCAGTCCTCTGTAC...

CDS

Download CDS FASTA

2406 bp · TkA02G558050|TK1151|CDS

ATGAAGACCACCAAAGTGCCAATACTGAATCCCCCTCTTGTCGCTTTCGAACATAAGAGAGACGCCTATGGTTTTGCAGTGAGACCTCAGCATGTACAGAGATACCGTGAATACGCTAGTATCTACAAGGAGGAAGAGGAAGAACGGTCAGATAGGTGGAAGGACTTTCTAGAAAGGCAATCAGAAGGTGCTCAATTGCCTGTAAATGGCTCTGATAAGACCCCAGAAGGAGATGACTTAAGCACTGAGAAGCCTGTTCA...

Protein

Download Protein FASTA

801 aa · TkA02G558050|TK1151|PROTEIN

MKTTKVPILNPPLVAFEHKRDAYGFAVRPQHVQRYREYASIYKEEEEERSDRWKDFLERQSEGAQLPVNGSDKTPEGDDLSTEKPVHDDVKDSQPQEDEVSETKSHGVQIWTQIRPSLRAIEDTMNARVKRKISETKTDENNETEDVASEDSEDEFYDLDRSESDPTPDNIPSSDGVTPSIPGADGTVPPESSIPWKRELEFLVQGGVPMALRGELWQAFVGVKARHIDKYYQNLLLSDSKNDDNNVGQQISEEDKKMNN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G558050`
TK1151 ID	TkA02G558050
OH-1004 ID	LXL04_012491
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	97.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G558050`
Location	Chr02:144149851-144154596 (+)
Description	Similar to Tbc1d8: TBC1 domain family member 8
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_012491` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0003008 system process Biological Process GO:0008015 blood circulation Biological Process GO:0008284 positive regulation of cell population proliferation Biological Process GO:0090630 activation of GTPase activity Biological Process GO:0005737 cytoplasm Cellular Component GO:0016020 membrane Cellular Component GO:0043332 mating projection tip Cellular Component GO:0005096 GTPase activator activity Molecular Function GO:0005509 calcium ion binding Molecular Function
KEGG gene cross-reference	hsa:11138 hsa:23158 mmu:54610 mmu:71310 sce:YGR100W These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.436

Rank 1 · TkA02G558050 · TK1151

Golgi apparatus0.255

Rank 2 · TkA02G558050 · TK1151

Cell membrane0.240

Rank 3 · TkA02G558050 · TK1151

Nucleus0.177

Rank 4 · TkA02G558050 · TK1151

Endoplasmic reticulum0.105

Rank 5 · TkA02G558050 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16788ATF7IP_BD124-143 aa

PF00566RabGAP-TBC211-433 aa

PF23436RabGap-TBC_2294-455 aa

PF16788ATF7IP_BD596-684 aa

PF00566RabGAP-TBC615-648 aa

PF16788ATF7IP_BD726-787 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G558050	`PF16788`	ATF7IP_BD	124	143	0.51	11.3
TkA02G558050	`PF00566`	RabGAP-TBC	211	433	1.7e-52	178.9
TkA02G558050	`PF23436`	RabGap-TBC_2	294	455	1.6e-25	90.8
TkA02G558050	`PF16788`	ATF7IP_BD	596	684	0.51	11.3
TkA02G558050	`PF00566`	RabGAP-TBC	615	648	1.7e-52	178.9
TkA02G558050	`PF16788`	ATF7IP_BD	726	787	0.51	11.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card