TkA02G556990 | RubberDandelionOmics

Gene overview

TkA02G556990

Reference: TK1151 Chr: Chr02 Coordinates: 143845513-143849188 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3282 bp · TkA02G556990|TK1151|cDNA

TATATACTAAAAAAATTGGAAGCCTCTTCTTCTTCTTCTTCTTCTACTTCTTCGTCTGGTTTTGTTCGCAATCTCACCACCACCATATCCCTCTTTCTATACGTATAAGTACCCATCCATCGGAACACATATGCCCTAGATTTCTTCCAGTATCCCCTAATTTTTCCAGGTAAAGTTTTCTCTTACAATTGCAGATTTCAATCAAGAAATGACGTGTACAGATACAGATTCCAACCTCACTGTACAGTAGGCGTTTCCTG...

CDS

Download CDS FASTA

2370 bp · TkA02G556990|TK1151|CDS

ATGGTGAATGTGAATGGGAATGACCCGTTAGAGTCCTTTCTTAATTCGATTGAACTCGTGAAGAATGCTCTTGGTCCGCTTGAATCCAATTTCAGGAAAGCCGCAAAAGACTTTGAGCATCGATGGCCTGGAACTAAAAACGAACGTAAGACAGGAGAAATCGCCATGGGAAATGGAAATAAACCTCAATCGTTTAGCGTGAAGAAAAAGAACGACCAAGATACAGTTACCGATCAAAAAAAGAAGGGTTCGTCAACTAA...

Protein

Download Protein FASTA

789 aa · TkA02G556990|TK1151|PROTEIN

MVNVNGNDPLESFLNSIELVKNALGPLESNFRKAAKDFEHRWPGTKNERKTGEIAMGNGNKPQSFSVKKKNDQDTVTDQKKKGSSTKVPFKTFFSIFTHNDDHKADISNSKKELDDQESTKDDETCINCMQFAVSWSLVVSSFVQAVPAPFRNGKKKLQKKTNDNNSKISKGVFQENIPFDKNHTETKHNLLFIPHQETLKVKDENINNPSLDHLLGFLFDHLAQNLQKFELNATLLESKKADFSDFLGNLKFARVGGVP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G556990`
TK1151 ID	TkA02G556990
OH-1004 ID	LXL04_012510
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 96.691 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G556990

Location Chr02:143845513-143849188 (+)

Description Similar to slc25a26: S-adenosylmethionine mitochondrial carrier protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g34065`	Probable S-adenosylmethionine (SAM) transporter able to catalyze both uniport and exchange reactions through membranes.	No verified direct reference in this release
`At4g39460`	Transporter involved in exchange reactions through membranes.	Molecular identification of an Arabidopsis S-adenosylmethionine transporter. Analysis of organ distribution, bacterial expression, reconstitution into liposomes, and functional characterization.2006 · DOI: 10.1104/pp.106.086975 Arabidopsis SAMT1 defines a plastid transporter regulating plastid biogenesis and plant development.2006 · DOI: 10.1105/tpc.105.040741

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012510 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009658 chloroplast organization Biological Process

GO:0015805 S-adenosyl-L-methionine transport Biological Process

GO:0015866 ADP transport Biological Process

GO:0015867 ATP transport Biological Process

GO:1990543 mitochondrial S-adenosyl-L-methionine transmembrane transport Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0031969 chloroplast membrane Cellular Component

KEGG gene cross-reference

ath:AT1G34065

ath:AT4G39460

dre:560478

sce:YNL003C

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.412

Rank 1 · TkA02G556990 · TK1151

Plastid0.320

Rank 2 · TkA02G556990 · TK1151

Cytoplasm0.100

Rank 3 · TkA02G556990 · TK1151

Endoplasmic reticulum0.072

Rank 4 · TkA02G556990 · TK1151

Cell membrane0.051

Rank 5 · TkA02G556990 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23999CUSTOS76-167 aa

PF13499EF-hand_785-104 aa

PF18405SLC25_like137-174 aa

PF00036EF-hand_1314-324 aa

PF13405EF-hand_6353-378 aa

PF00036EF-hand_1353-378 aa

PF13499EF-hand_7353-379 aa

PF13202EF-hand_5355-373 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G556990	`PF23999`	CUSTOS	76	167	0.25	11.5
TkA02G556990	`PF13499`	EF-hand_7	85	104	0.013	16.6
TkA02G556990	`PF18405`	SLC25_like	137	174	0.019	14.8
TkA02G556990	`PF00036`	EF-hand_1	314	324	9.2e-05	22.4
TkA02G556990	`PF13405`	EF-hand_6	353	378	2.2e-05	24.5
TkA02G556990	`PF00036`	EF-hand_1	353	378	9.2e-05	22.4
TkA02G556990	`PF13499`	EF-hand_7	353	379	0.013	16.6
TkA02G556990	`PF13202`	EF-hand_5	355	373	0.0044	17.2
TkA02G556990	`PF13405`	EF-hand_6	423	446	2.2e-05	24.5
TkA02G556990	`PF00036`	EF-hand_1	429	443	9.2e-05	22.4
TkA02G556990	`PF13202`	EF-hand_5	429	438	0.0044	17.2
TkA02G556990	`PF13499`	EF-hand_7	429	454	0.013	16.6
TkA02G556990	`PF00153`	Mito_carr	513	594	2.2e-48	162.7
TkA02G556990	`PF18405`	SLC25_like	530	576	0.019	14.8
TkA02G556990	`PF00153`	Mito_carr	606	686	2.2e-48	162.7
TkA02G556990	`PF00153`	Mito_carr	691	780	2.2e-48	162.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4HT41`	Arabidopsis thaliana	sp\|F4HT41\|SAMC2_ARATH Probable S-adenosylmethionine carrier 2, chloroplastic	32.400%	Swiss-Prot	Low
`Q94AG6`	Arabidopsis thaliana	sp\|Q94AG6\|SAMC1_ARATH S-adenosylmethionine carrier 1, chloroplastic/mitochondrial	31.100%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card