TkA02G554150 | RubberDandelionOmics

Gene overview

TkA02G554150

Reference: TK1151 Chr: Chr02 Coordinates: 142982518-142984212 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

917 bp · TkA02G554150|TK1151|cDNA

ATGGAGGTAAATGATTTAAAATAGTAGTCTATTATCTAAATATATGTATGATGTTATGTTGGTAGATGAAACTAAAAGTAGTATGCTTAAATGGCCTCAACGCTTATGCATTATCAACGGGATTGCTAGAGGTATGCTTTATCTCCATCAAGATTCACGCCTTCGAATCATACACAGAGACCTGAAAGCAGCCAATGTTTTGCTTGATGATGACATGAACCCCAAAATATCCGACTTTGGCCTTGCTAGAGAGATTGAAG...

CDS

Download CDS FASTA

699 bp · TkA02G554150|TK1151|CDS

ATGTATGATGTTATGTTGGTAGATGAAACTAAAAGTAGTATGCTTAAATGGCCTCAACGCTTATGCATTATCAACGGGATTGCTAGAGGTATGCTTTATCTCCATCAAGATTCACGCCTTCGAATCATACACAGAGACCTGAAAGCAGCCAATGTTTTGCTTGATGATGACATGAACCCCAAAATATCCGACTTTGGCCTTGCTAGAGAGATTGAAGGAAACCAAAACACAGCCGAAACCAAGAAAGTGGTTGGAACATA...

Protein

Download Protein FASTA

232 aa · TkA02G554150|TK1151|PROTEIN

MYDVMLVDETKSSMLKWPQRLCIINGIARGMLYLHQDSRLRIIHRDLKAANVLLDDDMNPKISDFGLAREIEGNQNTAETKKVVGTYGYISPEYALHGRFSVKSDVFSFGVLVLEIVSGKKIREFSHEDHIDTIFGHAWRLYTEGKCIDLMSLSLRDSCVISEVKRSIHVGLLCVQNHAQDRPNMSSVVMMLGGDGPLPPPKQPAFFDKKGSSKHNTFSGVDEATITLLYPR

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G554150`
TK1151 ID	TkA02G554150
OH-1004 ID	LXL04_012531
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	90.200
Protein coverage (%)	TK1151 96.983 / OH-1004 15.374 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G554150

Location Chr02:142982518-142984212 (-)

Description Similar to At4g27290: G-type lectin S-receptor-like serine/threonine-protein kinase At4g27290

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g27300`	G-type lectin S-receptor-like serine/threonine-protein kinase SD1-1.	No verified direct reference in this release
`At4g27290`	G-type lectin S-receptor-like serine/threonine-protein kinase At4g27290.	No verified direct reference in this release
`At4g23140`	Cysteine-rich receptor-like protein kinase 6.	No verified direct reference in this release
`At4g23160`	Cysteine-rich receptor-like protein kinase 8.	No verified direct reference in this release
`At4g21390`	G-type lectin S-receptor-like serine/threonine-protein kinase B120.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012531 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006955 immune response Biological Process

GO:0007165 signal transduction Biological Process

GO:0048544 recognition of pollen Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0004675 transmembrane receptor protein serine/threonine kinase activity Molecular Function

GO:0005516 calmodulin binding Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT4G21380

ath:AT4G27290

ath:AT4G27300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.589

Rank 1 · TkA02G554150 · TK1151

Cytoplasm0.358

Rank 2 · TkA02G554150 · TK1151

Nucleus0.216

Rank 3 · TkA02G554150 · TK1151

Endoplasmic reticulum0.038

Rank 4 · TkA02G554150 · TK1151

Golgi apparatus0.035

Rank 5 · TkA02G554150 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11883DUF34038-22 aa

PF07714PK_Tyr_Ser-Thr12-185 aa

PF00069Pkinase22-131 aa

PF03109ABC132-76 aa

PF01636APH36-58 aa

PF12330Haspin_kinase37-71 aa

PF17667Pkinase_fungal40-109 aa

PF03109ABC1104-127 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G554150	`PF11883`	DUF3403	8	22	0.0062	17.3
TkA02G554150	`PF07714`	PK_Tyr_Ser-Thr	12	185	1e-28	101.1
TkA02G554150	`PF00069`	Pkinase	22	131	8.6e-27	94.9
TkA02G554150	`PF03109`	ABC1	32	76	0.005	16.8
TkA02G554150	`PF01636`	APH	36	58	0.043	14.3
TkA02G554150	`PF12330`	Haspin_kinase	37	71	0.3	10.8
TkA02G554150	`PF17667`	Pkinase_fungal	40	109	0.049	13.1
TkA02G554150	`PF03109`	ABC1	104	127	0.005	16.8
TkA02G554150	`PF01636`	APH	111	140	0.043	14.3
TkA02G554150	`PF11883`	DUF3403	196	232	0.0062	17.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O81833`	Arabidopsis thaliana	sp\|O81833\|SD11_ARATH G-type lectin S-receptor-like serine/threonine-protein kinase SD1-1	55.600%	Swiss-Prot	High
`O81832`	Arabidopsis thaliana	sp\|O81832\|Y4729_ARATH G-type lectin S-receptor-like serine/threonine-protein kinase At4g27290	57.800%	Swiss-Prot	High
`Q9C5S9`	Arabidopsis thaliana	sp\|Q9C5S9\|CRK6_ARATH Cysteine-rich receptor-like protein kinase 6	52.500%	Swiss-Prot	High
`O65468`	Arabidopsis thaliana	sp\|O65468\|CRK8_ARATH Cysteine-rich receptor-like protein kinase 8	51.700%	Swiss-Prot	High
`O81906`	Arabidopsis thaliana	sp\|O81906\|B120_ARATH G-type lectin S-receptor-like serine/threonine-protein kinase B120	57.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card