TkA02G549740 | RubberDandelionOmics

Gene overview

TkA02G549740

Reference: TK1151 Chr: Chr02 Coordinates: 141851387-141853678 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1416 bp · TkA02G549740|TK1151|cDNA

AAAAATGCTAGTATACTGCTAAACGCCTAAACCCTTTCTAGTTTCACAGGGTCAAAATCATCATTCCGGTTCAACTTGACAGCCGCCGCGCGAACCACCGTCTCTGTTGCCATCATGTCCGTCGCTACCATCGTTCCGGCCCCTCTCACATCCTCAAATATCCGATCACGTTCAATCATATCCCCGTCCTCCTTTTCTCCCATCAACCCCTTCAAATGCTCTACTTTTGCCCTCCAATTTAACACCGCCAAGCTCACAAC...

CDS

Download CDS FASTA

1116 bp · TkA02G549740|TK1151|CDS

ATGTCCGTCGCTACCATCGTTCCGGCCCCTCTCACATCCTCAAATATCCGATCACGTTCAATCATATCCCCGTCCTCCTTTTCTCCCATCAACCCCTTCAAATGCTCTACTTTTGCCCTCCAATTTAACACCGCCAAGCTCACAACCACTTCTCTCATCCGAAACCCTAACTTCCGATTCGGTGTCTCAGCAATGAGCGTAGCAGCTCAGGAAAATCTCTCTAAGACCGCATTCCTCGATCGAAGAGAAAGCGGAGTTCT...

Protein

Download Protein FASTA

371 aa · TkA02G549740|TK1151|PROTEIN

MSVATIVPAPLTSSNIRSRSIISPSSFSPINPFKCSTFALQFNTAKLTTTSLIRNPNFRFGVSAMSVAAQENLSKTAFLDRRESGVLHFVKYHGLGNDFIMVNNLDSTDPKVTPEQAAKLCDRNFGIGADGVIFAMPGHNGTDYTMRIFNSDGSEPEMCGNGVRCFAKFIADLNSSEGRQSFTVHTGAGLIVPEIQDDGQVKVDMGEPVLKASDVPTKIPPNVNESVVKAKIEVDGTNWNVTCVSMGNPHCVTFGTQAND...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G549740`
TK1151 ID	TkA02G549740
OH-1004 ID	LXL04_012614
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G549740

Location Chr02:141851387-141853678 (+)

Description Similar to DAPF: Diaminopimelate epimerase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g53580`	Racemase that operates by a 'two-base' mechanism, which involves one active-site cysteine acting as a base to abstract the alpha-proton of an amino acid, while a second cysteine thiol functions as an acid to reprotonate the resulting planar carbanionic intermediate from the opposite face.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os12g0567200`	Diaminopimelate epimerase, chloroplastic.	No verified direct reference in this release
`UniProt: A2ZLS4`	Putative diaminopimelate epimerase, chloroplastic.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012614 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009089 L-lysine biosynthetic process via diaminopimelate Biological Process

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0008837 diaminopimelate epimerase activity Molecular Function

KEGG gene cross-reference

ana:alr2048

ath:AT3G53580

dosa:Os12g0567200

syn:slr1665

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.985

Rank 1 · TkA02G549740 · TK1151

Mitochondrion0.030

Rank 2 · TkA02G549740 · TK1151

Cytoplasm0.026

Rank 3 · TkA02G549740 · TK1151

Peroxisome0.021

Rank 4 · TkA02G549740 · TK1151

Nucleus0.015

Rank 5 · TkA02G549740 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01678DAP_epimerase89-210 aa

PF26317CntK_N156-356 aa

PF01678DAP_epimerase243-364 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G549740	`PF01678`	DAP_epimerase	89	210	1.1e-71	239.2
TkA02G549740	`PF26317`	CntK_N	156	356	0.00013	22.2
TkA02G549740	`PF01678`	DAP_epimerase	243	364	1.1e-71	239.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LFG2`	Arabidopsis thaliana	sp\|Q9LFG2\|DAPF_ARATH Diaminopimelate epimerase, chloroplastic	74.000%	Swiss-Prot	High
`Q2QNF7`	Oryza sativa subsp. japonica	sp\|Q2QNF7\|DAPF_ORYSJ Diaminopimelate epimerase, chloroplastic	73.700%	Swiss-Prot	High
`A2ZLS4`	Oryza sativa subsp. indica	sp\|A2ZLS4\|DAPF_ORYSI Putative diaminopimelate epimerase, chloroplastic	73.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card