TkA02G546670 | RubberDandelionOmics

Gene overview

TkA02G546670

Reference: TK1151 Chr: Chr02 Coordinates: 141043459-141046050 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1810 bp · TkA02G546670|TK1151|cDNA

GGAATATTGTAACCGACGTGGCGATGAATCAGGATGACAAGTATACACCGTTAGATCAACACGTATCCAGTGGTCGACAGTAAAACCCTAAGCATATAAATATCTCGATACTGCTTCATTTCTTCCACACTCGCTGAGTTTTGCTTCTCTTCTTTGTTTCTCAATTACACTACTTCATTAGAGAAAATACAGATTTACAAGTATGGGCAAAGAAAAGGTTCATATCAACATCGTCGTCATCGGCCATGTCGACTCCGGGA...

CDS

Download CDS FASTA

1344 bp · TkA02G546670|TK1151|CDS

ATGGGCAAAGAAAAGGTTCATATCAACATCGTCGTCATCGGCCATGTCGACTCCGGGAAATCAACCACTACCGGTCACTTAATCTACAAGCTTGGAGGAATCGACAAGCGTGTGATTGAGCGATTTGAGAAAGAAGCAGCTGAGATGAACAAACGTTCATTTAAGTACGCTTGGGTGCTCGATAAACTCAAAGCCGAGCGTGAACGTGGTATCACCATTGATATCGCTTTATGGAAATTCGAAACCAACAAGTACTACTG...

Protein

Download Protein FASTA

447 aa · TkA02G546670|TK1151|PROTEIN

MGKEKVHINIVVIGHVDSGKSTTTGHLIYKLGGIDKRVIERFEKEAAEMNKRSFKYAWVLDKLKAERERGITIDIALWKFETNKYYCTVIDAPGHRDFIKNMITGTSQADCAVLIIDSTTGGFEAGISKDGQTREHALLAFTLGVKQMICCCNKMDATTPKYSKARYDEIIKEVSSYLKKVGYNPDKIPFVPISGFEGDNMIERSTNLDWYKGPTLLEALDSINEPKRPTDKPLRLPLQDVYKIGGIGTVPVGRVETGVI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G546670`
TK1151 ID	TkA02G546670
OH-1004 ID	LXL04_012664
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G546670

Location Chr02:141043459-141046050 (+)

Description Similar to REFA1: Elongation factor 1-alpha

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g07940`	This protein promotes the GTP-dependent binding of aminoacyl-tRNA to the A-site of ribosomes during protein biosynthesis.	No verified direct reference in this release
`At1g07930`	This protein promotes the GTP-dependent binding of aminoacyl-tRNA to the A-site of ribosomes during protein biosynthesis.	No verified direct reference in this release
`At1g07920`	This protein promotes the GTP-dependent binding of aminoacyl-tRNA to the A-site of ribosomes during protein biosynthesis.	No verified direct reference in this release
`At5g60390`	This protein promotes the GTP-dependent binding of aminoacyl-tRNA to the A-site of ribosomes during protein biosynthesis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012664 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006412 translation Biological Process

GO:0006414 translational elongation Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G07920

ath:AT1G07930

ath:AT1G07940

ath:AT5G60390

osa:4331811

osa:4331812

osa:4331813

sly:101244084

sly:544055

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.768

Rank 1 · TkA02G546670 · TK1151

Nucleus0.194

Rank 2 · TkA02G546670 · TK1151

Cell membrane0.136

Rank 3 · TkA02G546670 · TK1151

Mitochondrion0.074

Rank 4 · TkA02G546670 · TK1151

Endoplasmic reticulum0.070

Rank 5 · TkA02G546670 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00009GTP_EFTU6-222 aa

PF03144GTP_EFTU_D210-23 aa

PF13401AAA_2210-117 aa

PF28277FcpA37-101 aa

PF01926MMR_HSR162-124 aa

PF09439SRPRB83-174 aa

PF03144GTP_EFTU_D2248-313 aa

PF14578GTP_EFTU_D4252-304 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G546670	`PF00009`	GTP_EFTU	6	222	1.1e-58	198.6
TkA02G546670	`PF03144`	GTP_EFTU_D2	10	23	4.7e-16	59.7
TkA02G546670	`PF13401`	AAA_22	10	117	0.15	13.1
TkA02G546670	`PF28277`	FcpA	37	101	0.13	12.0
TkA02G546670	`PF01926`	MMR_HSR1	62	124	0.0018	19.1
TkA02G546670	`PF09439`	SRPRB	83	174	0.15	12.1
TkA02G546670	`PF03144`	GTP_EFTU_D2	248	313	4.7e-16	59.7
TkA02G546670	`PF14578`	GTP_EFTU_D4	252	304	0.024	15.3
TkA02G546670	`PF03143`	GTP_EFTU_D3	322	429	7.2e-27	94.5
TkA02G546670	`PF22594`	GTP-eEF1A_C	327	427	6.1e-37	126.8
TkA02G546670	`PF00009`	GTP_EFTU	363	380	1.1e-58	198.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P0DH99`	Arabidopsis thaliana	sp\|P0DH99\|EF1A1_ARATH Elongation factor 1-alpha 1	96.600%	Swiss-Prot	High
`Q8W4H7`	Arabidopsis thaliana	sp\|Q8W4H7\|EF1A2_ARATH Elongation factor 1-alpha 2	96.600%	Swiss-Prot	High
`Q0WL56`	Arabidopsis thaliana	sp\|Q0WL56\|EF1A3_ARATH Elongation factor 1-alpha 3	96.600%	Swiss-Prot	High
`Q8GTY0`	Arabidopsis thaliana	sp\|Q8GTY0\|EF1A4_ARATH Elongation factor 1-alpha 4	96.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card