Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2048 bp · TkA02G541230|TK1151|cDNA
AAAATTACAAAAGCAAGTCAGGCACCTAGCTCGCAAACCACGTGTAGGTTCGGTATAGAAAAATGTAAAGTGGGGCGCCGTTCAACTTTTACTCTATGTCTACAGTCTCTTCCGCCCCTTGTATGCGCATTTTCTCCTCCCCGCCACTACCACAAGTCCCCCAAAACTGCAATGACGACACCGGCTACGACGTGCTCTCTCTGGAAGGCGGTTAAAGCACCAGTAAACTGCAGTAACAGGAGCGGAGTGGAACTAGGAAC...
1665 bp · TkA02G541230|TK1151|CDS
AAAATTACAAAAGCAAGTCAGGCACCTAGCTCGCAAACCACGTGTAGGTTCGGTATAGAAAAATGTAAAGTGGGGCGCCGTTCAACTTTTACTCTATGTCTACAGTCTCTTCCGCCCCTTGTATGCGCATTTTCTCCTCCCCGCCACTACCACAAGTCCCCCAAAACTGCAATGACGACACCGGCTACGACGTGCTCTCTCTGGAAGGCGGTTAAAGCACCAGTAAACTGCAGTAACAGGAGCGGAGTGGAACTAGGAAC...
Protein
Download Protein FASTA554 aa · TkA02G541230|TK1151|PROTEIN
KITKASQAPSSQTTCRFGIEKCKVGRRSTFTLCLQSLPPLVCAFSPPRHYHKSPKTAMTTPATTCSLWKAVKAPVNCSNRSGVELGTLVKGLSLKIASNRKCAGCSTLKVVNAISNTGNGSASGGTSATLPLSPADNGAASPLCSKVKRHTISVFVGDESGIINRIAGVFARRGYNIESLAVGLNKDKALFTIVVSGSEKVLRQVVEQLNKLVNVLKVEDLSKEPQVERELMLVKLDVNQSTRAEIMWLADIFRAKVVDA...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA02G541230 |
|---|---|
| TK1151 ID | TkA02G541230 |
| OH-1004 ID | LXL04_012728 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 99.200 |
| Protein coverage (%) | TK1151 89.711 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA02G541230 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr02:139650361-139653564 (-) | |||||||||
| Description | Similar to VAT1: Acetolactate synthase small subunit 1, chloroplastic | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0001666 response to hypoxia Biological Process GO:0006551 L-leucine metabolic process Biological Process GO:0006573 valine metabolic process Biological Process GO:0009082 branched-chain amino acid biosynthetic process Biological Process GO:0009097 isoleucine biosynthetic process Biological Process GO:0009099 L-valine biosynthetic process Biological Process GO:0005777 peroxisome Cellular Component GO:0005829 cytosol Cellular Component GO:0009507 chloroplast Cellular Component GO:0003984 acetolactate synthase activity Molecular Function GO:1990610 acetolactate synthase regulator activity Molecular Function | |||||||||
| KEGG gene cross-reference | ath:AT2G31810 ath:AT5G16290 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF01842ACT150-213 aaPF13291ACT_4151-219 aaPF22629ACT_AHAS_ss152-217 aaPF13710ACT_5160-218 aaPF08753NikR_C179-218 aaPF10369ALS_ss_C190-211 aaPF10369ALS_ss_C229-302 aaPF01842ACT385-449 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA02G541230 | PF01842 | ACT | 150 | 213 | 4.3e-22 | 78.2 |
| TkA02G541230 | PF13291 | ACT_4 | 151 | 219 | 6.2e-09 | 37.1 |
| TkA02G541230 | PF22629 | ACT_AHAS_ss | 152 | 217 | 1.7e-40 | 137.7 |
| TkA02G541230 | PF13710 | ACT_5 | 160 | 218 | 1.3e-20 | 73.6 |
| TkA02G541230 | PF08753 | NikR_C | 179 | 218 | 0.043 | 14.7 |
| TkA02G541230 | PF10369 | ALS_ss_C | 190 | 211 | 7.8e-53 | 177.2 |
| TkA02G541230 | PF10369 | ALS_ss_C | 229 | 302 | 7.8e-53 | 177.2 |
| TkA02G541230 | PF01842 | ACT | 385 | 449 | 4.3e-22 | 78.2 |
| TkA02G541230 | PF13291 | ACT_4 | 385 | 429 | 6.2e-09 | 37.1 |
| TkA02G541230 | PF22629 | ACT_AHAS_ss | 387 | 453 | 1.7e-40 | 137.7 |
| TkA02G541230 | PF13710 | ACT_5 | 394 | 455 | 1.3e-20 | 73.6 |
| TkA02G541230 | PF08753 | NikR_C | 430 | 456 | 0.043 | 14.7 |
| TkA02G541230 | PF10369 | ALS_ss_C | 466 | 538 | 7.8e-53 | 177.2 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.