TkA02G541100 | RubberDandelionOmics

Gene overview

TkA02G541100

Reference: TK1151 Chr: Chr02 Coordinates: 139604915-139608595 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3294 bp · TkA02G541100|TK1151|cDNA

ATGAACAAACAAGATGCAAGGAGTCTAGCTTCGTACCTGCCCGGAAAGCTTCAAACAGCCGGGTATCGTCGCCGGCTTGGTTCAGCGGTCGCCGGAGCTTCTCCAACCAGTAGCCACTTCGTCCAAACTCGAACACTCGACCTCGCTAAGCAGCTTCGGTACCTTCACGATTTGTCTCAAGCTCCGACGATAATCAGAAGGGAAGAAGGTGGAGAATGGGATGAAACCGGCAGAGAGGGACGCCGTCGGGAAGCTCCTCG...

CDS

Download CDS FASTA

3294 bp · TkA02G541100|TK1151|CDS

ATGAACAAACAAGATGCAAGGAGTCTAGCTTCGTACCTGCCCGGAAAGCTTCAAACAGCCGGGTATCGTCGCCGGCTTGGTTCAGCGGTCGCCGGAGCTTCTCCAACCAGTAGCCACTTCGTCCAAACTCGAACACTCGACCTCGCTAAGCAGCTTCGGTACCTTCACGATTTGTCTCAAGCTCCGACGATAATCAGAAGGGAAGAAGGTGGAGAATGGGATGAAACCGGCAGAGAGGGACGCCGTCGGGAAGCTCCTCG...

Protein

Download Protein FASTA

1097 aa · TkA02G541100|TK1151|PROTEIN

MNKQDARSLASYLPGKLQTAGYRRRLGSAVAGASPTSSHFVQTRTLDLAKQLRYLHDLSQAPTIIRREEGGEWDETGREGRRREAPRSSPTEHEQHRLTSFVLLSLTFLSLSLSHRWTEKKKVKKMGSKGGGANQSRVSRYLSLSLCSRCRRRSGLWRQSLGWRRWRLEVKLASIILRCFAERTTGSDNASKLLLTLIYAIYTDQNIDIGHILWTQFCLSPNSSTRTTHISMARFWGIVVDGALNKFKDLKGDENVLMAD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G541100`
TK1151 ID	TkA02G541100
OH-1004 ID	LXL04_003522
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	96.100
Protein coverage (%)	TK1151 85.050 / OH-1004 85.091 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G541100`
Location	Chr02:139604915-139608595 (+)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_003522` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.884

Rank 1 · TkA02G541100 · TK1151

Cytoplasm0.205

Rank 2 · TkA02G541100 · TK1151

Mitochondrion0.028

Rank 3 · TkA02G541100 · TK1151

Cell membrane0.024

Rank 4 · TkA02G541100 · TK1151

Endoplasmic reticulum0.014

Rank 5 · TkA02G541100 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05531NPV_P10526-567 aa

PF04513Baculo_PEP_C528-602 aa

PF05531NPV_P10579-624 aa

PF18013Phage_lysozyme2591-644 aa

PF27944CEP162_coil_mid602-624 aa

PF04513Baculo_PEP_C638-680 aa

PF21928XLF_CC649-671 aa

PF05531NPV_P10653-687 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G541100	`PF05531`	NPV_P10	526	567	2.0	9.7
TkA02G541100	`PF04513`	Baculo_PEP_C	528	602	0.18	12.5
TkA02G541100	`PF05531`	NPV_P10	579	624	2.0	9.7
TkA02G541100	`PF18013`	Phage_lysozyme2	591	644	0.24	12.3
TkA02G541100	`PF27944`	CEP162_coil_mid	602	624	0.058	14.1
TkA02G541100	`PF04513`	Baculo_PEP_C	638	680	0.18	12.5
TkA02G541100	`PF21928`	XLF_CC	649	671	0.36	11.5
TkA02G541100	`PF05531`	NPV_P10	653	687	2.0	9.7
TkA02G541100	`PF27944`	CEP162_coil_mid	660	669	0.058	14.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card