TkA02G537320 | RubberDandelionOmics

Gene overview

TkA02G537320

Reference: TK1151 Chr: Chr02 Coordinates: 138565156-138571090 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1735 bp · TkA02G537320|TK1151|cDNA

TGAAGATAGAACGGTTTCTCACCCACCTCGGCAACCAGCTTTGTCTCCTCCAATTAGAATCCCCTTGCCGCCCATTGCCACATTCTACACCTGCTTGCTTTCATCCAATTACAAACCGATCGCCGCCCATTGCCACCTCCGCATGTCGTCATGGCCGGCTCAGCTGACTGCCTAATTGCTTCCCGTCCGTTATCTTATCGTGTTGATGTTGTGCCACTACCGCCTTTCCTTTTAGCCGCCTCAAACGACTACTTATTCAG...

CDS

Download CDS FASTA

972 bp · TkA02G537320|TK1151|CDS

ATGGCCCCGAAAGACGAAATTGATGGAATGAGCTTCGAGCAGAGGCATGGAAAGGAGCGGGTTAGAGTTGGTAGAGTCTGGAGATCCGGAGAAGATGGCCGCCACTTCTTCGTCGAATGGAACGTCAGTATCAGTCTCCTCTCTGATTGTATTCCGTCATACGTTCGCGCGGATAATTCCGATATCGTCGCAACCGATACCATGAAAAACACTGTACGTTATCTACTTGACTACTGTTTCATTCTGGATGTATATGTAAA...

Protein

Download Protein FASTA

323 aa · TkA02G537320|TK1151|PROTEIN

MAPKDEIDGMSFEQRHGKERVRVGRVWRSGEDGRHFFVEWNVSISLLSDCIPSYVRADNSDIVATDTMKNTVRYLLDYCFILDVYVKAKECSEKVSVEEFAILLAKHFTSFYPQVTTAIIKIVEKPWERISISGQPHNHGFKLGSERHTTQVILNKNGNLQLTSGVDGLALLKTTQSGFEGFIRDLNTILPETRERMLATEVSASWRYQFESLQSISRGPLGFTEKYLDVKKVLVDTFFGPPKQGVYSPSVQATLYDMAK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G537320`
TK1151 ID	TkA02G537320
OH-1004 ID	LXL04_012810
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G537320

Location Chr02:138565156-138571090 (-)

Description Similar to At2g26230: Uricase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g26230`	Catalyzes the oxidation of uric acid to 5-hydroxyisourate, which is further processed to form (S)-allantoin.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012810 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006145 purine nucleobase catabolic process Biological Process

GO:0007031 peroxisome organization Biological Process

GO:0009877 nodulation Biological Process

GO:0019628 urate catabolic process Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005829 cytosol Cellular Component

GO:0004846 urate oxidase activity Molecular Function

KEGG gene cross-reference

ath:AT2G26230

gmx:100037445

gmx:547453

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Peroxisome0.506

Rank 1 · TkA02G537320 · TK1151

Cytoplasm0.270

Rank 2 · TkA02G537320 · TK1151

Mitochondrion0.263

Rank 3 · TkA02G537320 · TK1151

Nucleus0.108

Rank 4 · TkA02G537320 · TK1151

Cell membrane0.043

Rank 5 · TkA02G537320 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01014Uricase15-152 aa

PF27097VirB4_TrbE_N151-196 aa

PF01014Uricase163-313 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G537320	`PF01014`	Uricase	15	152	5.6e-61	205.8
TkA02G537320	`PF27097`	VirB4_TrbE_N	151	196	0.11	13.1
TkA02G537320	`PF01014`	Uricase	163	313	5.6e-61	205.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O04420`	Arabidopsis thaliana	sp\|O04420\|URIC_ARATH Uricase	74.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card