TkA02G530230 | RubberDandelionOmics

Gene overview

TkA02G530230

Reference: TK1151 Chr: Chr02 Coordinates: 136726162-136727775 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1560 bp · TkA02G530230|TK1151|cDNA

ATGGATAGATTGATCAGTTTAGAGCCATCAAACACGGTTGTGATACGAATCGAACACGGTCAAAAATGTTCCGGTGAGCTCACTTTGAAAAACGTGATGTACACCATGCCTGTGGCTTTCCGGTTGCAACCGGTCAACAAGGCTCGGTACACGGTCAAACCACAATCCGGGATCATATCTCCGTTAACAACTCTTACGGTTGAGATCACTTACGACTTCCATCAAAACTCAAGTCTCCCTACTTCGGTCCCTTACTGTGA...

CDS

Download CDS FASTA

1560 bp · TkA02G530230|TK1151|CDS

ATGGATAGATTGATCAGTTTAGAGCCATCAAACACGGTTGTGATACGAATCGAACACGGTCAAAAATGTTCCGGTGAGCTCACTTTGAAAAACGTGATGTACACCATGCCTGTGGCTTTCCGGTTGCAACCGGTCAACAAGGCTCGGTACACGGTCAAACCACAATCCGGGATCATATCTCCGTTAACAACTCTTACGGTTGAGATCACTTACGACTTCCATCAAAACTCAAGTCTCCCTACTTCGGTCCCTTACTGTGA...

Protein

Download Protein FASTA

519 aa · TkA02G530230|TK1151|PROTEIN

MDRLISLEPSNTVVIRIEHGQKCSGELTLKNVMYTMPVAFRLQPVNKARYTVKPQSGIISPLTTLTVEITYDFHQNSSLPTSVPYCDDSFLLHSVVVPGAAMKNPSSTHDSVPNDWFTARKKQVFVDSGIRVMFVGSVVMASLVKNGSIDEIRDVLEKGDPNWRAVDSLDNEGQPLLHLAIGQSRPDLVQLLLEFEPDLEARNMLGLTPLEAASALGEGLIVELLLAHRASTARSETSTWGAIHLAAGGGHVDVLRLLLL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G530230`
TK1151 ID	TkA02G530230
OH-1004 ID	LXL04_012926
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	94.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G530230

Location Chr02:136726162-136727775 (-)

Description Similar to VPY: Protein VAPYRIN

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0128700`	Probable E3 ubiquitin-protein ligase XBOS36.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012926 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002237 response to molecule of bacterial origin Biological Process

GO:0009609 response to symbiotic bacterium Biological Process

GO:0009610 response to symbiotic fungus Biological Process

GO:0009877 nodulation Biological Process

GO:0010247 detection of phosphate ion Biological Process

GO:0015969 guanosine tetraphosphate metabolic process Biological Process

GO:0036377 arbuscular mycorrhizal association Biological Process

GO:0085020 protein K6-linked ubiquitination Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

mtr:11415982

mtr:25495843

rfe:RF_0381

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.482

Rank 1 · TkA02G530230 · TK1151

Nucleus0.320

Rank 2 · TkA02G530230 · TK1151

Cell membrane0.143

Rank 3 · TkA02G530230 · TK1151

Mitochondrion0.069

Rank 4 · TkA02G530230 · TK1151

Golgi apparatus0.066

Rank 5 · TkA02G530230 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00635Motile_Sperm5-108 aa

PF22076Cep192_D67-72 aa

PF22067Cep192_D311-76 aa

PF22544HYDIN_VesB_CFA65-like_Ig17-72 aa

PF13637Ank_4143-193 aa

PF12796Ank_2145-230 aa

PF24521Ank_KRIT1145-197 aa

PF18418AnkUBD147-193 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G530230	`PF00635`	Motile_Sperm	5	108	2.2e-09	37.9
TkA02G530230	`PF22076`	Cep192_D6	7	72	0.09	13.7
TkA02G530230	`PF22067`	Cep192_D3	11	76	0.097	13.5
TkA02G530230	`PF22544`	HYDIN_VesB_CFA65-like_Ig	17	72	0.24	12.3
TkA02G530230	`PF13637`	Ank_4	143	193	2.6e-50	168.0
TkA02G530230	`PF12796`	Ank_2	145	230	3.4e-60	201.3
TkA02G530230	`PF24521`	Ank_KRIT1	145	197	8.4e-15	55.5
TkA02G530230	`PF18418`	AnkUBD	147	193	0.016	16.1
TkA02G530230	`PF13857`	Ank_5	165	211	5.1e-45	151.7
TkA02G530230	`PF13606`	Ank_3	172	200	5.5e-42	137.1
TkA02G530230	`PF00023`	Ank	173	203	1.9e-55	182.4
TkA02G530230	`PF13637`	Ank_4	177	214	2.6e-50	168.0
TkA02G530230	`PF23745`	ANK_LRRK2	186	196	0.00015	22.3
TkA02G530230	`PF00023`	Ank	206	231	1.9e-55	182.4
TkA02G530230	`PF13606`	Ank_3	206	229	5.5e-42	137.1
TkA02G530230	`PF24521`	Ank_KRIT1	209	262	8.4e-15	55.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q4JHE0`	Oryza sativa subsp. japonica	sp\|Q4JHE0\|XB36_ORYSJ Probable E3 ubiquitin-protein ligase XBOS36	35.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card