TkA02G528320 | RubberDandelionOmics

Gene overview

TkA02G528320

Reference: TK1151 Chr: Chr02 Coordinates: 136244896-136251019 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2298 bp · TkA02G528320|TK1151|cDNA

ATGGAGACGGGGTTGCCATGGATCATCAATGGAGACGGGGTTGCCATGGATCCTCAATGGAGACGGGGTTGCCATGGATCCTCAATGGAGACGGGGTTGCGTGGATTTATGGGACTCACGGGATACTATCGGAAATTTGTGCAGAATTACGGGAGCATCGCCCGTCCCTTAACAGAACTGACCAAACGTGACTCGATCCAATGGAGTGATGTGGCTCAAGTGGCTTTTGAAGCTTTGAAGAGAGCCTTGGCTTTAAGCCC...

CDS

Download CDS FASTA

2298 bp · TkA02G528320|TK1151|CDS

ATGGAGACGGGGTTGCCATGGATCATCAATGGAGACGGGGTTGCCATGGATCCTCAATGGAGACGGGGTTGCCATGGATCCTCAATGGAGACGGGGTTGCGTGGATTTATGGGACTCACGGGATACTATCGGAAATTTGTGCAGAATTACGGGAGCATCGCCCGTCCCTTAACAGAACTGACCAAACGTGACTCGATCCAATGGAGTGATGTGGCTCAAGTGGCTTTTGAAGCTTTGAAGAGAGCCTTGGCTTTAAGCCC...

Protein

Download Protein FASTA

765 aa · TkA02G528320|TK1151|PROTEIN

METGLPWIINGDGVAMDPQWRRGCHGSSMETGLRGFMGLTGYYRKFVQNYGSIARPLTELTKRDSIQWSDVAQVAFEALKRALALSPTNLAKSAYEREIMALVLAVQHWRSYLLGAAFIIYTDQKSLKFLLQQRITTPDQQNWVAKILGYNFEIRYKPGRENRTADALSRRAEAELGSMSLSEPLWLQGAQLLGECKLDSDIQQLGLKYATTPPESYGYHVRVGVLYYKNRLVISKTSVFVPLLLREFHQSASGGHSGYY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G528320`
TK1151 ID	TkA02G528320
OH-1004 ID	LXL04_025668
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	67.600
Protein coverage (%)	TK1151 73.987 / OH-1004 36.741 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G528320

Location Chr02:136244896-136251019 (-)

Description Similar to TY3B-G: Transposon Ty3-G Gag-Pol polyprotein (Saccharomyces cerevisiae (strain ATCC 204508 / S288c)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g16340`	May be a general defense protein.	No verified direct reference in this release
`At2g29940`	Together with ABCG25, export abscisic acid (ABA) from the endosperm to deliver it to the embryo via ABCG30 and ABCG40-mediated import to suppress radicle extension and subsequent embryonic growth.	The role of Arabidopsis ABCG9 and ABCG31 ATP binding cassette transporters in pollen fitness and the deposition of steryl glycosides on the pollen coat.2014 · DOI: 10.1105/tpc.113.118935 Abscisic acid transporters cooperate to control seed germination.2015 · DOI: 10.1038/ncomms9113
`At1g59870`	Together with ABCG37, regulates auxin homeostasis and responses by playing a dual role in coumarin (e.g. esculin) and in the auxin precursor indole 3-butyric acid (IBA) efflux transport, thus influencing cotyledons, roots and root hairs development.	Loss of AtPDR8, a plasma membrane ABC transporter of Arabidopsis thaliana, causes hypersensitive cell death upon pathogen infection.2006 · DOI: 10.1093/pcp/pcj001 Arabidopsis PEN3/PDR8, an ATP binding cassette transporter, contributes to nonhost resistance to inappropriate pathogens that enter by direct penetration.2006 · DOI: 10.1105/tpc.105.038372 The ABC transporter AtPDR8 is a cadmium extrusion pump conferring heavy metal resistance.2007 · DOI: 10.1111/j.1365-313x.2007.03044.x Extracellular transport and integration of plant secretory proteins into pathogen-induced cell wall compartments.2009 · DOI: 10.1111/j.1365-313x.2008.03743.x Glucosinolate metabolites required for an Arabidopsis innate immune response.2009 · DOI: 10.1126/science.1164627 The Arabidopsis PLEIOTROPIC DRUG RESISTANCE8/ABCG36 ATP binding cassette transporter modulates sensitivity to the auxin precursor indole-3-butyric acid.2009 · DOI: 10.1105/tpc.109.065821 Overexpression of AtABCG36 improves drought and salt stress resistance in Arabidopsis.2010 · DOI: 10.1111/j.1399-3054.2010.01353.x Arabidopsis PIS1 encodes the ABCG37 transporter of auxinic compounds including the auxin precursor indole-3-butyric acid.2010 · DOI: 10.1073/pnas.1005878107 Induction and suppression of PEN3 focal accumulation during Pseudomonas syringae pv. tomato DC3000 infection of Arabidopsis.2013 · DOI: 10.1094/mpmi-11-12-0262-r Role of the penetration-resistance genes PEN1, PEN2 and PEN3 in the hypersensitive response and race-specific resistance in Arabidopsis thaliana.2014 · DOI: 10.1111/tpj.12571 Mutant Allele-Specific Uncoupling of PENETRATION3 Functions Reveals Engagement of the ATP-Binding Cassette Transporter in Distinct Tryptophan Metabolic Pathways.2015 · DOI: 10.1104/pp.15.00182 ABC transporter PEN3/PDR8/ABCG36 interacts with calmodulin that, like PEN3, is required for Arabidopsis nonhost resistance.2016 · DOI: 10.1111/nph.13582 An Arabidopsis Lipid Flippase Is Required for Timely Recruitment of Defenses to the Host-Pathogen Interface at the Plant Cell Surface.2017 · DOI: 10.1016/j.molp.2017.04.003 Arabidopsis Transporter ABCG37/PDR9 contributes primarily highly oxygenated Coumarins to Root Exudation.2017 · DOI: 10.1038/s41598-017-03250-6 Expression analysis of transporter genes for screening candidate monolignol transporters using Arabidopsis thaliana cell suspensions during tracheary element differentiation.2018 · DOI: 10.1007/s10265-017-0979-4 Arabidopsis BTB/POZ protein-dependent PENETRATION3 trafficking and disease susceptibility.2017 · DOI: 10.1038/s41477-017-0039-z

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0724500`	May be a general defense protein.	No verified direct reference in this release
`UniProt: A2WSH0`	May be a general defense protein.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025668 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006310 DNA recombination Biological Process

GO:0006508 proteolysis Biological Process

GO:0015074 DNA integration Biological Process

GO:0075523 viral translational frameshifting Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0003723 RNA binding Molecular Function

GO:0003887 DNA-directed DNA polymerase activity Molecular Function

GO:0003964 RNA-directed DNA polymerase activity Molecular Function

GO:0004190 aspartic-type endopeptidase activity Molecular Function

GO:0004519 endonuclease activity Molecular Function

KEGG gene cross-reference

sce:YGR109W-B

sce:YIL082W-A

spo:2542672

spo:2542797

spo:2543673

spo:3361218

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.514

Rank 1 · TkA02G528320 · TK1151

Nucleus0.220

Rank 2 · TkA02G528320 · TK1151

Peroxisome0.141

Rank 3 · TkA02G528320 · TK1151

Mitochondrion0.133

Rank 4 · TkA02G528320 · TK1151

Endoplasmic reticulum0.055

Rank 5 · TkA02G528320 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17919RT_RNaseH_268-87 aa

PF17917RT_RNaseH85-150 aa

PF17919RT_RNaseH_285-120 aa

PF17921Integrase_H2C2242-294 aa

PF09337zf-H2C2256-290 aa

PF00665rve314-408 aa

PF14533USP7_C2362-376 aa

PF29688TnsB_C364-424 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G528320	`PF17919`	RT_RNaseH_2	68	87	4.5e-05	24.2
TkA02G528320	`PF17917`	RT_RNaseH	85	150	4.4e-13	50.0
TkA02G528320	`PF17919`	RT_RNaseH_2	85	120	4.5e-05	24.2
TkA02G528320	`PF17921`	Integrase_H2C2	242	294	2.1e-17	63.7
TkA02G528320	`PF09337`	zf-H2C2	256	290	0.0082	17.2
TkA02G528320	`PF00665`	rve	314	408	1.6e-08	35.4
TkA02G528320	`PF14533`	USP7_C2	362	376	4.4e-08	33.8
TkA02G528320	`PF29688`	TnsB_C	364	424	0.0024	18.4
TkA02G528320	`PF09337`	zf-H2C2	415	422	0.0082	17.2
TkA02G528320	`PF20886`	PWP3A-B_C	461	515	0.096	12.9
TkA02G528320	`PF17919`	RT_RNaseH_2	492	514	4.5e-05	24.2
TkA02G528320	`PF24626`	SH3_Tf2-1	525	570	6.1e-10	39.8
TkA02G528320	`PF31073`	DUF8803	541	570	0.032	14.8
TkA02G528320	`PF14533`	USP7_C2	546	624	4.4e-08	33.8
TkA02G528320	`PF17917`	RT_RNaseH	598	608	4.4e-13	50.0
TkA02G528320	`PF17919`	RT_RNaseH_2	598	608	4.5e-05	24.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94A18`	Arabidopsis thaliana	sp\|Q94A18\|AB29G_ARATH ABC transporter G family member 29	67.000%	Swiss-Prot	Low
`Q7PC88`	Arabidopsis thaliana	sp\|Q7PC88\|AB31G_ARATH ABC transporter G family member 31	65.500%	Swiss-Prot	Low
`Q9XIE2`	Arabidopsis thaliana	sp\|Q9XIE2\|AB36G_ARATH ABC transporter G family member 36	63.100%	Swiss-Prot	Low
`Q7FMW4`	Oryza sativa subsp. japonica	sp\|Q7FMW4\|AB38G_ORYSJ ABC transporter G family member 38	64.800%	Swiss-Prot	Low
`A2WSH0`	Oryza sativa subsp. indica	sp\|A2WSH0\|AB36G_ORYSI ABC transporter G family member 36	70.800%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card