TkA02G525640 | RubberDandelionOmics

Gene overview

TkA02G525640

Reference: TK1151 Chr: Chr02 Coordinates: 135574764-135581902 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

6618 bp · TkA02G525640|TK1151|cDNA

AGTTTGGAACAAGTTAATATGTATTTCGAATTTCATTTTAGTCATCTTTCTAGTTTTACAAAAATAAGTTATTTTAAATAAAAAATAAGCTATTTTTAAAATATACATGAGTAGTTGTGCTATTTTTGTCAATATTCACGCATTTGAAGTGAACCGGGTCCGAATAATTCAACGCCGAACGGGGCACAGCACATTTGAAGAACAATGAGACAACGACAGAGACGAGGCGGCTTACTCAAAACTTATGAAAACTTCAAACA...

CDS

Download CDS FASTA

3168 bp · TkA02G525640|TK1151|CDS

ATGGCGATGTCACTCGAGGATCTTCTTACAGAAGAGGGTTTCAAAAGCAGCACTAGTTCCAGGAGAATGACGAGAGCATCATCTGGACTCGTAAGAACAATACCAACCCACCCAATTCGCGATGAACACAAATCTGGTATCCCAATTCGTTTAAGAAAAACAGAAAGGGCATATTCAGATACACGTAGATACGATAAACGTGTTGAATCTCCCCTAACTGACAAAATCAAGGGTAGAAGATCAGTAGACGTTATCAAAAG...

Protein

Download Protein FASTA

1055 aa · TkA02G525640|TK1151|PROTEIN

MAMSLEDLLTEEGFKSSTSSRRMTRASSGLVRTIPTHPIRDEHKSGIPIRLRKTERAYSDTRRYDKRVESPLTDKIKGRRSVDVIKRDKLDRVSSKERHVRRASQDAHNVPGYSIDSSQPLSLDEIVEVKEGTQKVKPDKGKYKDIYLNDVFSPPIAKNEEKDVQIDNGYGNLPGSSSIKSNRSSTQNKDSITRARRPVDIESIPEVALDDIAIKAMTSILSGYVKTFLKSQDFRTSMYHNCFSAINFSKLEEEIVAESK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G525640`
TK1151 ID	TkA02G525640
OH-1004 ID	LXL04_012973
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G525640

Location Chr02:135574764-135581902 (-)

Description Similar to CERBERUS: Putative E3 ubiquitin-protein ligase LIN-1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g29340`	Functions as an E3 ubiquitin ligase.	The E3 ubiquitin ligase activity of arabidopsis PLANT U-BOX17 and its functional tobacco homolog ACRE276 are required for cell death and defense.2006 · DOI: 10.1105/tpc.105.039198

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0657100`	E3 ubiquitin-protein ligase that functions as a negative regulator of brassinosteroid (BR) signaling.	OsBZR1 turnover mediated by OsSK22-regulated U-box E3 ligase OsPUB24 in rice BR response.2019 · DOI: 10.1111/tpj.14332

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012973 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009877 nodulation Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0061630 ubiquitin protein ligase activity Molecular Function

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.455

Rank 1 · TkA02G525640 · TK1151

Nucleus0.311

Rank 2 · TkA02G525640 · TK1151

Cell membrane0.311

Rank 3 · TkA02G525640 · TK1151

Endoplasmic reticulum0.061

Rank 4 · TkA02G525640 · TK1151

Plastid0.057

Rank 5 · TkA02G525640 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23568ARM_LIN213-435 aa

PF25472DUF7902262-298 aa

PF25472DUF7902376-403 aa

PF04564U-box587-658 aa

PF11789zf-Nse589-631 aa

PF23628ARM_LIN_C688-1046 aa

PF23568ARM_LIN794-825 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G525640	`PF23568`	ARM_LIN	213	435	1.3e-92	310.0
TkA02G525640	`PF25472`	DUF7902	262	298	0.27	12.2
TkA02G525640	`PF25472`	DUF7902	376	403	0.27	12.2
TkA02G525640	`PF04564`	U-box	587	658	1.7e-11	44.8
TkA02G525640	`PF11789`	zf-Nse	589	631	2.1e-05	24.9
TkA02G525640	`PF23628`	ARM_LIN_C	688	1046	7.5e-141	470.1
TkA02G525640	`PF23568`	ARM_LIN	794	825	1.3e-92	310.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C7R6`	Arabidopsis thaliana	sp\|Q9C7R6\|PUB17_ARATH U-box domain-containing protein 17	39.100%	Swiss-Prot	Low
`Q10FT0`	Oryza sativa subsp. japonica	sp\|Q10FT0\|PUB24_ORYSJ U-box domain-containing protein 24	28.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card