TkA02G525040 | RubberDandelionOmics

Gene overview

TkA02G525040

Reference: TK1151 Chr: Chr02 Coordinates: 135382823-135387337 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1338 bp · TkA02G525040|TK1151|cDNA

AAAAAAAGGTCAGGTTTAATTTTACTCCAAATCGATTCCTAAGGGGATTGATTCCTTGTGCGCGATCTGTTTGTGTGAATACAGAGAAGCGGAGATGATGAGGATGTTGCCTGATTGAAACTCAACGCCAGCTGTCCTGTTTGTCGGAGCTCGCCGCTTCCGACGCCGTTGTCTACTCCGTTAGCGGAAGTTGTTCCTCTCTCACAATACTCCGACGGCCATCACTAGATCTCGTCTTCTATTTCTACTATTTGTTCTCA...

CDS

Download CDS FASTA

681 bp · TkA02G525040|TK1151|CDS

ATGAATCATCAAGGTGTTATCTTGAATGGACGGTTTCTGTTGAAGATTATAGTGACAGATCATAAAGATTCTCGTTTATTAAGAGCATGTGCTAGAGAAGCTAACTACCACCACCTTCAAATCCTTATAAATGATTTCTCTATACCGAGTCAGACAGTCCAAATTAAAGTGTATGAAAGAGAGGCGTTCCAGATGCAAGAACAGGCTCGGGAAATTCGGGGAAAGAAAAGGAGTTATCAAGATCGTGTTAAGGATCTTGA...

Protein

Download Protein FASTA

226 aa · TkA02G525040|TK1151|PROTEIN

MNHQGVILNGRFLLKIIVTDHKDSRLLRACAREANYHHLQILINDFSIPSQTVQIKVYEREAFQMQEQAREIRGKKRSYQDRVKDLEDELQNAKMAEYRISIYGRKQSECDNLASWTVNCTNPLYRNSTKEIIDNGLDVLVNANPGAPPLGPRRRLPPRTPLSGAAAPEPLQCLENGMDQCDGMKKEMLVDDRKGMLYSGMIVIPSKRGLAIPSYYPSFFVILFRA

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G525040`
TK1151 ID	TkA02G525040
OH-1004 ID	LXL04_024271
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.600
Protein coverage (%)	TK1151 62.832 / OH-1004 69.951 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G525040`
Location	Chr02:135382823-135387337 (-)
Description	Similar to SMC6B: Structural maintenance of chromosomes protein 6B
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_024271` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000724 double-strand break repair via homologous recombination Biological Process GO:0006188 IMP biosynthetic process Biological Process GO:0006302 double-strand break repair Biological Process GO:0007062 sister chromatid cohesion Biological Process GO:0009793 embryo development ending in seed dormancy Biological Process GO:0010165 response to X-ray Biological Process GO:0032264 IMP salvage Biological Process GO:0046033 AMP metabolic process Biological Process GO:0005634 nucleus Cellular Component GO:0005741 mitochondrial outer membrane Cellular Component GO:0005783 endoplasmic reticulum Cellular Component GO:0005829 cytosol Cellular Component
KEGG gene cross-reference	ath:AT2G38280 ath:AT5G61460 dosa:Os07g0693500 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.440

Rank 1 · TkA02G525040 · TK1151

Nucleus0.369

Rank 2 · TkA02G525040 · TK1151

Mitochondrion0.149

Rank 3 · TkA02G525040 · TK1151

Cell membrane0.112

Rank 4 · TkA02G525040 · TK1151

Golgi apparatus0.066

Rank 5 · TkA02G525040 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10473CENP-F_leu_zip59-94 aa

PF28274INA17_C75-93 aa

PF19326AMP_deaminase79-119 aa

PF16984Grp7_allergen94-143 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G525040	`PF10473`	CENP-F_leu_zip	59	94	0.038	14.8
TkA02G525040	`PF28274`	INA17_C	75	93	0.24	11.7
TkA02G525040	`PF19326`	AMP_deaminase	79	119	1.9e-07	30.6
TkA02G525040	`PF16984`	Grp7_allergen	94	143	0.33	11.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card