TkA02G524230 | RubberDandelionOmics

Gene overview

TkA02G524230

Reference: TK1151 Chr: Chr02 Coordinates: 135166067-135168690 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2140 bp · TkA02G524230|TK1151|cDNA

CTGATTTCCCTGACCTGTAACGCATTTCAGAATTCAGAGTCATTCTAGTCTACCGTAGAACTAACGATGGCTCCGAAGGCGAAGCCCAAACCGGCGGCCGTGCCGGCTGTCTCCATTGAAGATCTTTTCACAACTCTTAATCGACATATACAAAGGTCAGAGTTCGATCAGGCCGTCAAGGTTGCAGATCAAGTTCTATCTGTTGCTCCTGGTGACGAAGATGCAATTCGATGTAAGATTGTGTCTTTAATTAAGGCTGA...

CDS

Download CDS FASTA

1980 bp · TkA02G524230|TK1151|CDS

ATGGCTCCGAAGGCGAAGCCCAAACCGGCGGCCGTGCCGGCTGTCTCCATTGAAGATCTTTTCACAACTCTTAATCGACATATACAAAGGTCAGAGTTCGATCAGGCCGTCAAGGTTGCAGATCAAGTTCTATCTGTTGCTCCTGGTGACGAAGATGCAATTCGATGTAAGATTGTGTCTTTAATTAAGGCTGATAATATCGATGATGCTCTTTCCACTATTGTCGCCTTGTCGAAGAAGTTTCCTTTCGATTTCGATTT...

Protein

Download Protein FASTA

659 aa · TkA02G524230|TK1151|PROTEIN

MAPKAKPKPAAVPAVSIEDLFTTLNRHIQRSEFDQAVKVADQVLSVAPGDEDAIRCKIVSLIKADNIDDALSTIVALSKKFPFDFDFFKAYCLYRQNKLDDALETLKSLEKDSATMLLESQILSRQGNMNAAVDVYQKLQKSKIALLEINLVAGLVSAGRATEVQGTLDSMRVKATSSFELAYNTACALIEKNKYSDAEQLLLSARRIGQESLMEDNFPDDEIEIELAPIAVQLAYVQQLLGNKQEAITSYTDLIKRNVP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G524230`
TK1151 ID	TkA02G524230
OH-1004 ID	LXL04_012997
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G524230`
Location	Chr02:135166067-135168690 (+)
Description	Similar to SRP72: Signal recognition particle subunit SRP72
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_012997` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006614 SRP-dependent cotranslational protein targeting to membrane Biological Process GO:0006617 SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition Biological Process GO:0005783 endoplasmic reticulum Cellular Component GO:0005786 signal recognition particle, endoplasmic reticulum targeting Cellular Component GO:0005829 cytosol Cellular Component GO:0048500 signal recognition particle Cellular Component GO:0003723 RNA binding Molecular Function GO:0005047 signal recognition particle binding Molecular Function GO:0008312 7S RNA binding Molecular Function GO:0030911 TPR domain binding Molecular Function GO:0043022 ribosome binding Molecular Function
KEGG gene cross-reference	cel:CELE_F08D12.1 cfa:403944 ddi:DDB_G0291412 hsa:6731 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.446

Rank 1 · TkA02G524230 · TK1151

Nucleus0.438

Rank 2 · TkA02G524230 · TK1151

Endoplasmic reticulum0.087

Rank 3 · TkA02G524230 · TK1151

Golgi apparatus0.084

Rank 4 · TkA02G524230 · TK1151

Cell membrane0.047

Rank 5 · TkA02G524230 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12895ANAPC318-74 aa

PF24603TPR_3024-47 aa

PF13428TPR_1425-56 aa

PF13371TPR_925-55 aa

PF13374TPR_1026-46 aa

PF13414TPR_1126-39 aa

PF13432TPR_1627-50 aa

PF07719TPR_227-50 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G524230	`PF12895`	ANAPC3	18	74	1.4e-07	32.4
TkA02G524230	`PF24603`	TPR_30	24	47	0.00013	23.0
TkA02G524230	`PF13428`	TPR_14	25	56	1.2e-15	57.2
TkA02G524230	`PF13371`	TPR_9	25	55	0.00025	21.7
TkA02G524230	`PF13374`	TPR_10	26	46	0.011	16.4
TkA02G524230	`PF13414`	TPR_11	26	39	0.78	10.2
TkA02G524230	`PF13432`	TPR_16	27	50	6.4e-14	52.8
TkA02G524230	`PF07719`	TPR_2	27	50	1.9e-10	40.8
TkA02G524230	`PF13429`	TPR_15	27	73	0.00036	20.8
TkA02G524230	`PF25064`	ARM_TT21_5th	28	113	1.7e-05	25.8
TkA02G524230	`PF14559`	TPR_19	29	84	3.1e-17	63.4
TkA02G524230	`PF13176`	TPR_7	29	53	1.1e-06	28.9
TkA02G524230	`PF00515`	TPR_1	29	49	1.6e-05	25.2
TkA02G524230	`PF13174`	TPR_6	32	48	1.4e-12	48.1
TkA02G524230	`PF12895`	ANAPC3	32	107	1.4e-07	32.4
TkA02G524230	`PF13181`	TPR_8	32	48	0.001	19.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card