TkA02G519480 | RubberDandelionOmics

Gene overview

TkA02G519480

Reference: TK1151 Chr: Chr02 Coordinates: 133897179-133900437 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2361 bp · TkA02G519480|TK1151|cDNA

GGTCACATGTTTGACCTGGACCTCCTGGTTTAAAAGGAAGGGAACCACTTTAAGTTTCGTGTTCAAGTTAATACATTTGAACTTCTGTTATTTCCACCCACTTCACATGATTCCTGATAGTTTTTGAAGCAACCCAATTAATGGCTATTCATCATTAGCGGTCTGCAACTCATCACCGGTCACTTTCCGGTGATCCATGCCCTTTTCAAAAAATTACTCCATAACTATAAACCCTCAGTTCTTACGAAATCAGATTACAG...

CDS

Download CDS FASTA

2187 bp · TkA02G519480|TK1151|CDS

ATGTCGTATGCTAATTCAAGATCTGTAAGATTTCACGACGATGGTGTGCCGTCAAAACTCCCGATGAACAAAGAAAACTTATTTAAGGTGAAATACGATCTTGAAGGTGAACAAAGAAGCGAGGAAAACGAGCGAACTTCATTGAAATCAAAAGTTCTTTCTAGAGTTTTTTCAGAAGATTACGAGAGAGTGAAAAAGAAAATATATGATCCTCGAGGATTAGCAATTCGAAAATGGAACAATATTTTCTTGTTCGCTTG...

Protein

Download Protein FASTA

728 aa · TkA02G519480|TK1151|PROTEIN

MSYANSRSVRFHDDGVPSKLPMNKENLFKVKYDLEGEQRSEENERTSLKSKVLSRVFSEDYERVKKKIYDPRGLAIRKWNNIFLFACLISLFVDPLFFYLPTVRTKNVCIHIGLNLEISLTIVRSLADIFYIIHIYIRFRTAYVAPSSRVFGRGELVIDSSKIAKKYIQGGLWIDVLAALPLPQMLIWLIIPSLSGSTMANTKNVLRFIIIFQYLPRLYLIFPLTSEIIEANGVMTETAWAGAAYNLMLYMLASHVLGAS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G519480`
TK1151 ID	TkA02G519480
OH-1004 ID	LXL04_013059
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G519480

Location Chr02:133897179-133900437 (+)

Description Similar to CNGC15C: Protein CNGC15c

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g28260`	Putative cyclic nucleotide-gated ion channel.	No verified direct reference in this release
`At2g24610`	Probable cyclic nucleotide-gated ion channel.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013059 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009617 response to bacterium Biological Process

GO:0009877 nodulation Biological Process

GO:0036377 arbuscular mycorrhizal association Biological Process

GO:0051592 response to calcium ion Biological Process

GO:0070588 calcium ion transmembrane transport Biological Process

GO:0071249 cellular response to nitrate Biological Process

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0031965 nuclear membrane Cellular Component

GO:0005249 voltage-gated potassium channel activity Molecular Function

GO:0005262 calcium channel activity Molecular Function

GO:0005516 calmodulin binding Molecular Function

KEGG gene cross-reference

ath:AT2G24610

ath:AT2G28260

mtr:11433273

mtr:25487817

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.893

Rank 1 · TkA02G519480 · TK1151

Cytoplasm0.092

Rank 2 · TkA02G519480 · TK1151

Endoplasmic reticulum0.058

Rank 3 · TkA02G519480 · TK1151

Nucleus0.030

Rank 4 · TkA02G519480 · TK1151

Golgi apparatus0.022

Rank 5 · TkA02G519480 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00520Ion_trans79-397 aa

PF00689Cation_ATPase_C80-103 aa

PF00689Cation_ATPase_C315-404 aa

PF00027cNMP_binding495-569 aa

PF00612IQ610-626 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G519480	`PF00520`	Ion_trans	79	397	2.6e-17	63.6
TkA02G519480	`PF00689`	Cation_ATPase_C	80	103	0.19	12.2
TkA02G519480	`PF00689`	Cation_ATPase_C	315	404	0.19	12.2
TkA02G519480	`PF00027`	cNMP_binding	495	569	8e-07	29.6
TkA02G519480	`PF00612`	IQ	610	626	0.45	11.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SL29`	Arabidopsis thaliana	sp\|Q9SL29\|CNG15_ARATH Putative cyclic nucleotide-gated ion channel 15	73.200%	Swiss-Prot	High
`Q9SJA4`	Arabidopsis thaliana	sp\|Q9SJA4\|CNG14_ARATH Probable cyclic nucleotide-gated ion channel 14	60.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card