TkA02G514110 | RubberDandelionOmics

Gene overview

TkA02G514110

Reference: TK1151 Chr: Chr02 Coordinates: 132355287-132355986 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

549 bp · TkA02G514110|TK1151|cDNA

ATGGGATACAAGGTCCACATCCAGAAGGAGTCACTAAAAGCTCAATACGACAAATCAGTTGACTGTTTGCAAAAGATCAAACTTGACTCTCAGCACATGATAAAATACAACCACATTGCCCGTACATATAATGTTACGGGTCAAACTTTAGGCAAAACCGAGGGAGAGGATCCCTCATTCACGGCTAGGGAGTTGCATGAAGTTTTCCCTGGCTCAATGCTCAATGAGGTGTTAGCACACATTCACAATACTACAGTAGG...

CDS

Download CDS FASTA

549 bp · TkA02G514110|TK1151|CDS

ATGGGATACAAGGTCCACATCCAGAAGGAGTCACTAAAAGCTCAATACGACAAATCAGTTGACTGTTTGCAAAAGATCAAACTTGACTCTCAGCACATGATAAAATACAACCACATTGCCCGTACATATAATGTTACGGGTCAAACTTTAGGCAAAACCGAGGGAGAGGATCCCTCATTCACGGCTAGGGAGTTGCATGAAGTTTTCCCTGGCTCAATGCTCAATGAGGTGTTAGCACACATTCACAATACTACAGTAGG...

Protein

Download Protein FASTA

182 aa · TkA02G514110|TK1151|PROTEIN

MGYKVHIQKESLKAQYDKSVDCLQKIKLDSQHMIKYNHIARTYNVTGQTLGKTEGEDPSFTARELHEVFPGSMLNEVLAHIHNTTVGNSLVRRLRVRSAYSYYIEDPANVQLGPNQVMEDLKEVYNHISSLDQCKEDLRTILQHKILVRTYKHEDYNVGDAFNYICEYEADNVEEFFWFSFG

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G514110`
TK1151 ID	TkA02G514110
OH-1004 ID	LXL04_013145
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	77.600
Protein coverage (%)	TK1151 100.000 / OH-1004 63.736 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G514110`
Location	Chr02:132355287-132355986 (-)
Description	Similar to MMD1: PHD finger protein MALE MEIOCYTE DEATH 1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_013145` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000212 meiotic spindle organization Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0006355 regulation of DNA-templated transcription Biological Process GO:0007060 male meiosis chromosome segregation Biological Process GO:0007140 male meiotic nuclear division Biological Process GO:0009555 pollen development Biological Process GO:0009846 pollen germination Biological Process GO:0010032 meiotic chromosome condensation Biological Process GO:0010208 pollen wall assembly Biological Process GO:0010628 positive regulation of gene expression Biological Process GO:0022414 reproductive process Biological Process GO:0043068 positive regulation of programmed cell death Biological Process
KEGG gene cross-reference	ath:AT1G33420 ath:AT1G66170 ath:AT2G01810 ath:AT5G22260 dosa:Os09g0449000 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.490

Rank 1 · TkA02G514110 · TK1151

Cytoplasm0.387

Rank 2 · TkA02G514110 · TK1151

Mitochondrion0.101

Rank 3 · TkA02G514110 · TK1151

Cell membrane0.058

Rank 4 · TkA02G514110 · TK1151

Extracellular0.045

Rank 5 · TkA02G514110 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23307SAM_KIDINS22019-54 aa

PF00800PDT113-146 aa

PF23307SAM_KIDINS220126-133 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G514110	`PF23307`	SAM_KIDINS220	19	54	0.17	12.4
TkA02G514110	`PF00800`	PDT	113	146	0.17	12.4
TkA02G514110	`PF23307`	SAM_KIDINS220	126	133	0.17	12.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card