TkA02G513850 | RubberDandelionOmics

Gene overview

TkA02G513850

Reference: TK1151 Chr: Chr02 Coordinates: 131939544-131943643 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2409 bp · TkA02G513850|TK1151|cDNA

GAAAACAACTTAACATCAGTGATGCAAATAAATAACAAAACATATATTAGTGTCTAGAATTCGAAATATCGTGTTCTAGAATCTAGATAATGAAAAAAAAAGTCAATTAAGAGATTAAGATGACTAGATCAGTAGTCAATCAAGTTTGACAATATTAGGGATAATTTAGTAATTTAAACCCTAAAGAGAAGAATTGTTGTTGTTAAGGTCGCCGACGGCTTCGTTGGCAATCACGTGCGTCTTGCAAAAGCCACCCATGT...

CDS

Download CDS FASTA

1332 bp · TkA02G513850|TK1151|CDS

ATGGGCGAGTGGGTGGTTGGAGCTTTTATTAACCTTTTTGGAAGCATTGCAATTAACTTCGGAACTAATCTTCTTAAATTGGGCCATGACGAGAGAGAAAGACATGCTGTGTTAGTTGAAGGAATAAATGGAAAAACGCTATTAAGGCCTATCATAAGCTTCCAGTCTTGGAGAATCGGTATTCTATTTTTCGCTTTCGGAAATGCCCTTAACTTTATTTCCTTCGGATATGCTGCTCAGTCACTTCTTGCAGCATTGGG...

Protein

Download Protein FASTA

443 aa · TkA02G513850|TK1151|PROTEIN

MGEWVVGAFINLFGSIAINFGTNLLKLGHDERERHAVLVEGINGKTLLRPIISFQSWRIGILFFAFGNALNFISFGYAAQSLLAALGSVQFVSNIAFAYFVLQKTVTVKVIVATTFIVFGNIFLVAFGNHQSPVYTQEQLAEKYSNITFLFYCLLLVVVVLMHHYVYRRGELLLSIPGKDLMRYWKLLLPFSFAVVSGAIGSCSVLFAKSLSNLLRLSMSSSYRLDSWFTYSILLLFLCTAGFWMARLNEGLSQFDAILI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G513850`
TK1151 ID	TkA02G513850
OH-1004 ID	LXL04_013164
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	96.900
Protein coverage (%)	TK1151 100.000 / OH-1004 57.568 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G513850

Location Chr02:131939544-131943643 (+)

Description Similar to At3g26670: Probable magnesium transporter NIPA8

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g26670`	Acts as a Mg(2+) transporter.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013164 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0015693 magnesium ion transport Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005769 early endosome Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0015095 magnesium ion transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT3G23870

ath:AT3G26670

cal:CAALFM_C210720CA

hsa:57185

hsa:79815

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.305

Rank 1 · TkA02G513850 · TK1151

Golgi apparatus0.263

Rank 2 · TkA02G513850 · TK1151

Cytoplasm0.219

Rank 3 · TkA02G513850 · TK1151

Cell membrane0.203

Rank 4 · TkA02G513850 · TK1151

Endoplasmic reticulum0.153

Rank 5 · TkA02G513850 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05653Mg_trans_NIPA6-309 aa

PF24432DUF755599-117 aa

PF24432DUF7555255-336 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G513850	`PF05653`	Mg_trans_NIPA	6	309	9e-22	78.3
TkA02G513850	`PF24432`	DUF7555	99	117	0.04	14.7
TkA02G513850	`PF24432`	DUF7555	255	336	0.04	14.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RWF4`	Arabidopsis thaliana	sp\|Q8RWF4\|NIPA8_ARATH Probable magnesium transporter NIPA8	64.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card