TkA02G513480 | RubberDandelionOmics

Gene overview

TkA02G513480

Reference: TK1151 Chr: Chr02 Coordinates: 131830647-131832974 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1253 bp · TkA02G513480|TK1151|cDNA

CAATGATTTTCTACCGTTGGATTTGAGCTTGAAATAAATGAGGATTGGATCAAAGCCAAAGCTGAAAATACTCGGATCAAATCCTTCGACTGGAGGTGGCAACAATGTCGATAATTCAAGCACCTGCCGGCTGCTGCGACCTTCTTTTCCTTAAACCCCTCAATTCTTCATCTATTCCGATTCGCAACTGCGTTTCATCTCTTCCATCACTCTCCCTGACCTCCATTAACACTACCCCTCTTTCTCTCAACAACCCTCGC...

CDS

Download CDS FASTA

888 bp · TkA02G513480|TK1151|CDS

ATGTCGATAATTCAAGCACCTGCCGGCTGCTGCGACCTTCTTTTCCTTAAACCCCTCAATTCTTCATCTATTCCGATTCGCAACTGCGTTTCATCTCTTCCATCACTCTCCCTGACCTCCATTAACACTACCCCTCTTTCTCTCAACAACCCTCGCAAACTCCTCACAGCCTCATGCTCCTTTCTCGACGACGCTGTCACAGGTTCTGCAGTTCAGGCGTTGGAGATTGATCCCATGTTAGATGTCAAGAAAAAGGCAAT...

Protein

Download Protein FASTA

295 aa · TkA02G513480|TK1151|PROTEIN

MSIIQAPAGCCDLLFLKPLNSSSIPIRNCVSSLPSLSLTSINTTPLSLNNPRKLLTASCSFLDDAVTGSAVQALEIDPMLDVKKKAMAISPGLKGTSIYLVGISSTMKTRVGNLLAEALRYYYFDSDNLVVEAAGGEAAAKQLLELDKVGFRESETEVLRQLSSMGRMVICAGNGAVQSSTNLSLLRHGISIWVDVPLDMVAKEILEDGVRLLGSEISPSASHSEVLSQLTVLYKEMQEAYAIADVTISLKKVAGVLGYE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G513480`
TK1151 ID	TkA02G513480
OH-1004 ID	LXL04_013179
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G513480

Location Chr02:131830647-131832974 (+)

Description Similar to SKL1: Probable inactive shikimate kinase like 1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g26900`	Required for chloroplast biogenesis.	Evolutionary diversification of plant shikimate kinase gene duplicates.2008 · DOI: 10.1371/journal.pgen.1000292

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0225800`	Catalyzes the specific phosphorylation of the 3-hydroxyl group of shikimic acid using ATP as a cosubstrate.	No verified direct reference in this release
`Os04g0640600`	Catalyzes the specific phosphorylation of the 3-hydroxyl group of shikimic acid using ATP as a cosubstrate.	No verified direct reference in this release
`Os02g0749300`	Catalyzes the specific phosphorylation of the 3-hydroxyl group of shikimic acid using ATP as a cosubstrate.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013179 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0008652 amino acid biosynthetic process Biological Process

GO:0009073 aromatic amino acid family biosynthetic process Biological Process

GO:0009423 chorismate biosynthetic process Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0010027 thylakoid membrane organization Biological Process

GO:0019632 shikimate metabolic process Biological Process

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0004765 shikimate kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT3G26900

dosa:Os02g0749300

dosa:Os04g0640600

dosa:Os06g0225800

sly:544078

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.964

Rank 1 · TkA02G513480 · TK1151

Mitochondrion0.038

Rank 2 · TkA02G513480 · TK1151

Nucleus0.037

Rank 3 · TkA02G513480 · TK1151

Cytoplasm0.024

Rank 4 · TkA02G513480 · TK1151

Cell membrane0.015

Rank 5 · TkA02G513480 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01202SKI108-240 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G513480	`PF01202`	SKI	108	240	8.4e-24	85.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LW20`	Arabidopsis thaliana	sp\|Q9LW20\|SKL1_ARATH Probable inactive shikimate kinase like 1, chloroplastic	56.800%	Swiss-Prot	High
`Q5NTH3`	Oryza sativa subsp. japonica	sp\|Q5NTH3\|SK2_ORYSJ Shikimate kinase 2, chloroplastic	37.100%	Swiss-Prot	Medium
`Q7X7H9`	Oryza sativa subsp. japonica	sp\|Q7X7H9\|SK3_ORYSJ Shikimate kinase 3, chloroplastic	35.600%	Swiss-Prot	Medium
`Q5NTH4`	Oryza sativa subsp. japonica	sp\|Q5NTH4\|SK1_ORYSJ Shikimate kinase 1, chloroplastic	36.100%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card