TkA02G510700 | RubberDandelionOmics

Gene overview

TkA02G510700

Reference: TK1151 Chr: Chr02 Coordinates: 131097748-131109809 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1906 bp · TkA02G510700|TK1151|cDNA

AGGCTTGCCGTTACAATTGGAAAAAAAAATGAATTAAAAAAACAAGAGCACTATATTCGTATGGAAGACTATTCTCATTCCTCTTAAATTCAAGATTGCCAAATGACTAACTACTCCAGTCTTTCTTCACTGAAGTGAAAGAATACATACCAGAGAAAAGAGATGATGTATCGGTTTTTGATCATCGTTGTTTGTTTTTGTTCCGTAAACTTAACGTCAACAAAGAGAATCGAGTATCTTCCTGGCTTTCAAGGACCTCT...

CDS

Download CDS FASTA

2913 bp · TkA02G510700|TK1151|CDS

ATGATTCCACGGAGTACGCACATACAAGCCAAAGTGCTTGTGTTTTGCCCAATTAAACTAATCGAATCAGGGAACTGTGGACCAGCACAATACAACGCCTATTGCCTACCAGAAGCAGCAGCAAGATCGGAACTCGGAAGCCTTAGCGCCGCAATTATTCTTACCCAGTTAGGCGCTCAAATGGTGAACAAAGCATGGCGGATCATACCACGACCAATCATGGAAACCGTTCTCAACAACCACGCTCACCGCCACCGTGT...

Protein

Download Protein FASTA

970 aa · TkA02G510700|TK1151|PROTEIN

MIPRSTHIQAKVLVFCPIKLIESGNCGPAQYNAYCLPEAAARSELGSLSAAIILTQLGAQMVNKAWRIIPRPIMETVLNNHAHRHRVHQPLIVHGPRGVGKTTLILERHLENWNKGPHVTGYVDFAQSIEENHPHHGHSFPWASWTNCKPPSLPTLRTQLEECLESMAEKGVQLGSISSHQICKTLGKWHNLDTSLKRIIQTKNETTTSKRALSNKVSTLSLWDKAVCTLTARLNATEIDEMLGLKEKGKTLSLQEASYY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G510700`
TK1151 ID	TkA02G510700
OH-1004 ID	LXL04_013226
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.500
Protein coverage (%)	TK1151 63.711 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G510700

Location Chr02:131097748-131109809 (-)

Description No functional description available

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g22970`	Probable carboxypeptidase.	No verified direct reference in this release
`At1g73300`	Probable carboxypeptidase.	No verified direct reference in this release
`At1g73290`	Probable carboxypeptidase.	No verified direct reference in this release
`At3g10450`	Probable carboxypeptidase.	No verified direct reference in this release
`At2g22920`	Probable carboxypeptidase.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013226 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source) No functional description available

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.275

Rank 1 · TkA02G510700 · TK1151

Lysosome / Vacuole0.190

Rank 2 · TkA02G510700 · TK1151

Cytoplasm0.182

Rank 3 · TkA02G510700 · TK1151

Extracellular0.126

Rank 4 · TkA02G510700 · TK1151

Cell membrane0.117

Rank 5 · TkA02G510700 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25201nSTAND676-109 aa

PF13191AAA_1680-148 aa

PF12775AAA_786-131 aa

PF24389ORC-CDC6-like88-105 aa

PF01637ATPase_288-119 aa

PF13173AAA_1489-127 aa

PF13401AAA_2289-122 aa

PF10443RNA1291-114 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G510700	`PF25201`	nSTAND6	76	109	0.047	14.4
TkA02G510700	`PF13191`	AAA_16	80	148	0.0014	19.9
TkA02G510700	`PF12775`	AAA_7	86	131	0.062	13.6
TkA02G510700	`PF24389`	ORC-CDC6-like	88	105	0.018	14.5
TkA02G510700	`PF01637`	ATPase_2	88	119	0.024	15.2
TkA02G510700	`PF13173`	AAA_14	89	127	0.002	18.8
TkA02G510700	`PF13401`	AAA_22	89	122	0.16	13.0
TkA02G510700	`PF10443`	RNA12	91	114	0.1	12.1
TkA02G510700	`PF13401`	AAA_22	183	212	0.16	13.0
TkA02G510700	`PF25201`	nSTAND6	224	257	0.047	14.4
TkA02G510700	`PF13173`	AAA_14	243	269	0.002	18.8
TkA02G510700	`PF24389`	ORC-CDC6-like	419	437	0.018	14.5
TkA02G510700	`PF00450`	Peptidase_S10	445	485	2.5e-87	294.7
TkA02G510700	`PF00450`	Peptidase_S10	628	833	2.5e-87	294.7
TkA02G510700	`PF01637`	ATPase_2	734	760	0.024	15.2
TkA02G510700	`PF00450`	Peptidase_S10	830	970	2.5e-87	294.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q2V465`	Arabidopsis thaliana	sp\|Q2V465\|SCP11_ARATH Serine carboxypeptidase-like 11	49.200%	Swiss-Prot	Medium
`Q9CAU3`	Arabidopsis thaliana	sp\|Q9CAU3\|SCPL2_ARATH Serine carboxypeptidase-like 2	51.200%	Swiss-Prot	High
`Q9CAU2`	Arabidopsis thaliana	sp\|Q9CAU2\|SCP5_ARATH Serine carboxypeptidase-like 5	50.900%	Swiss-Prot	High
`Q9SQX6`	Arabidopsis thaliana	sp\|Q9SQX6\|SCP7_ARATH Serine carboxypeptidase-like 7	49.500%	Swiss-Prot	Medium
`O81009`	Arabidopsis thaliana	sp\|O81009\|SCP12_ARATH Serine carboxypeptidase-like 12	45.500%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card