TkA02G509590 | RubberDandelionOmics

Gene overview

TkA02G509590

Reference: TK1151 Chr: Chr02 Coordinates: 130764278-130767888 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2932 bp · TkA02G509590|TK1151|cDNA

ATTTAACAGGTGCGTCTTTCATTTCCCTTTGACAAATCCATGCTGCAACGTTCATGGTTCATCCTCCCCCATTGACTTTTGATCTAGTCAGCCACTCGAACTCGTTCATAGATGTAACAATCACAAATCATTTTAATAATCATTCCATGTTCGTACCACATCCATGGGGTTCTGGCAGTTGAAAATCAGTGCCTAAACCCCAATTTTCAATTCATAATCGCCTGTTCTCCATCACCACCTCCTTCTCGCCATTTGACCCG...

CDS

Download CDS FASTA

2385 bp · TkA02G509590|TK1151|CDS

ATGATGGCAGGGTTATTGGCCGTAGTGGTGGGATTGTGTTTGATCAATATCGGATGGGGTCTGGAACCGCCGTACAGGATCCACACATTGTTTTCAGTTGAATGCCAAAATTACTTCGATTGGCAGACGGTGGGGCTTGTTCATAGCTTCCGGAAATCCGGTCAACCTGGCCCGATTACTCGGCTTCTCAGCTGCACCGATGAGGAGAAGAAGAATTACAGAGGAATGGAGTTGGCTCCCACCTTTGAAGTCCCTTCGAT...

Protein

Download Protein FASTA

794 aa · TkA02G509590|TK1151|PROTEIN

MMAGLLAVVVGLCLINIGWGLEPPYRIHTLFSVECQNYFDWQTVGLVHSFRKSGQPGPITRLLSCTDEEKKNYRGMELAPTFEVPSMSKHPRTGDWYPAINKPAGVVHWLKHSKDAQNVDWVVILDADMIIRGPILPWEIGAEKGRPVAAYYGYLVGCDNILAKLHTKNPELCDKVGGLLAMHIDDLRALAPMWLSKTEEVREDTAHWSTNITGDIYGKGWISEMYGYSFGAAEVGLRHKINDNLMIYPGYIPREGVEPI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G509590`
TK1151 ID	TkA02G509590
OH-1004 ID	LXL04_013247
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G509590

Location Chr02:130764278-130767888 (+)

Description Similar to SERGT1: Peptidyl serine alpha-galactosyltransferase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g01720`	Glycosyltransferase involved in the O-galactosylation of several proteins including extensins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013247 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000139 Golgi membrane Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0016757 glycosyltransferase activity Molecular Function

GO:1990585 hydroxyproline O-arabinosyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT3G01720

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.753

Rank 1 · TkA02G509590 · TK1151

Endoplasmic reticulum0.183

Rank 2 · TkA02G509590 · TK1151

Cytoplasm0.112

Rank 3 · TkA02G509590 · TK1151

Cell membrane0.059

Rank 4 · TkA02G509590 · TK1151

Extracellular0.052

Rank 5 · TkA02G509590 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23452HPAT28-240 aa

PF31159Rhodo_GlycoT89-136 aa

PF23452HPAT393-602 aa

PF31159Rhodo_GlycoT448-508 aa

PF10617DUF2474747-763 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G509590	`PF23452`	HPAT	28	240	3.2e-33	116.2
TkA02G509590	`PF31159`	Rhodo_GlycoT	89	136	0.019	15.3
TkA02G509590	`PF23452`	HPAT	393	602	3.2e-33	116.2
TkA02G509590	`PF31159`	Rhodo_GlycoT	448	508	0.019	15.3
TkA02G509590	`PF10617`	DUF2474	747	763	1.9	9.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VYF9`	Arabidopsis thaliana	sp\|Q8VYF9\|SRGT1_ARATH Peptidyl serine alpha-galactosyltransferase	72.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card