TkA02G508320 | RubberDandelionOmics

Gene overview

TkA02G508320

Reference: TK1151 Chr: Chr02 Coordinates: 130460548-130464129 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2381 bp · TkA02G508320|TK1151|cDNA

AAAAAACCTTTACCTTGTGCTTACCTCCTGGCTATCGTGTCACCTCTCGTTGTATAAATACCTTGGCCTCACTTCGACGCCTTTTTTTTTTCCACGCATCTCCGGCGAAGCGGCTTTTCCTCTCTTGTTGACATCTATACCTCCATAACCACCGAGAGGATGATCATTTAGAGAAATCAAGGAGATATATATTCTGTGTGGTGTACTGCTGTATCATCTTTGACATCTAATTGCTGACATGGCTGCTGCTGGTCCACGCT...

CDS

Download CDS FASTA

1983 bp · TkA02G508320|TK1151|CDS

ATGGCTGCTGCTGGTCCACGCTATGCTCCAGAGGATCCCTCTCTCCCCAAACCATGGAGAGGTCTAGTTGATGGTAACACCGGGAATCTCTACTTTTGGAATCCAGTCACTAATGTCACCCAATATCAAAGACCCTCAGTACCGAATGATCCACCTCCACCTCAAATGCAGCCTCCAGTTTCCCCAGCCACTCAGGTGCAACCATCTTCCCAAGATGACAGTGGTGTTACTGATGATGACGTCATCACACATGAAAGAAG...

Protein

Download Protein FASTA

660 aa · TkA02G508320|TK1151|PROTEIN

MAAAGPRYAPEDPSLPKPWRGLVDGNTGNLYFWNPVTNVTQYQRPSVPNDPPPPQMQPPVSPATQVQPSSQDDSGVTDDDVITHERSGNGETKCHEPTNGVSDNTYVNETPKETVVHMPSVGSGLSPDAYRKKHEITVSGDNVPPPFTSFQETCFPSELLKDLIKTGFSAPTPIQAQSWPIAMQNRDIVAVAKTGSGKTLGYLIPGFIHLKKTRKNPQLSPTVLVLSPTRELATQIQDEAIKFGKGSRISCTCLYGGAPK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G508320`
TK1151 ID	TkA02G508320
OH-1004 ID	LXL04_013276
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G508320

Location Chr02:130460548-130464129 (+)

Description Similar to RH46: DEAD-box ATP-dependent RNA helicase 46

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g01540`	ATP-dependent RNA helicase involved nonsense-mediated mRNA decay and ribosome biogenesis through rRNA processing.	Characterization of a DEAD box ATPase/RNA helicase protein of Arabidopsis thaliana.1998 · DOI: 10.1093/nar/26.11.2638
`At5g14610`	DEAD-box ATP-dependent RNA helicase 46.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0172200`	ATP-dependent RNA helicase involved nonsense-mediated mRNA decay and ribosome biogenesis through rRNA processing.	No verified direct reference in this release
`Os01g0549400`	ATP-dependent RNA helicase involved nonsense-mediated mRNA decay and ribosome biogenesis through rRNA processing.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013276 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000184 nuclear-transcribed mRNA catabolic process, nonsense-mediated decay Biological Process

GO:0006364 rRNA processing Biological Process

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0003724 RNA helicase activity Molecular Function

GO:0003729 mRNA binding Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0016887 ATP hydrolysis activity Molecular Function

KEGG gene cross-reference

ath:AT3G01540

ath:AT5G14610

dosa:Os01g0172200

dosa:Os01g0549400

nsy:104219642

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.628

Rank 1 · TkA02G508320 · TK1151

Cytoplasm0.478

Rank 2 · TkA02G508320 · TK1151

Endoplasmic reticulum0.068

Rank 3 · TkA02G508320 · TK1151

Cell membrane0.052

Rank 4 · TkA02G508320 · TK1151

Mitochondrion0.035

Rank 5 · TkA02G508320 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00397WW15-45 aa

PF00270DEAD172-341 aa

PF04851ResIII183-335 aa

PF00271Helicase_C221-263 aa

PF00271Helicase_C379-487 aa

PF00270DEAD383-450 aa

PF04851ResIII387-450 aa

PF16203ERCC3_RAD25_C390-489 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G508320	`PF00397`	WW	15	45	2.9e-06	27.9
TkA02G508320	`PF00270`	DEAD	172	341	2.3e-53	181.1
TkA02G508320	`PF04851`	ResIII	183	335	2.2e-11	44.7
TkA02G508320	`PF00271`	Helicase_C	221	263	6.4e-36	123.7
TkA02G508320	`PF00271`	Helicase_C	379	487	6.4e-36	123.7
TkA02G508320	`PF00270`	DEAD	383	450	2.3e-53	181.1
TkA02G508320	`PF04851`	ResIII	387	450	2.2e-11	44.7
TkA02G508320	`PF16203`	ERCC3_RAD25_C	390	489	0.0017	18.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8H136`	Arabidopsis thaliana	sp\|Q8H136\|RH14_ARATH DEAD-box ATP-dependent RNA helicase 14	61.400%	Swiss-Prot	High
`Q9LYJ9`	Arabidopsis thaliana	sp\|Q9LYJ9\|RH46_ARATH DEAD-box ATP-dependent RNA helicase 46	62.600%	Swiss-Prot	High
`Q5VQL1`	Oryza sativa subsp. japonica	sp\|Q5VQL1\|RH14_ORYSJ DEAD-box ATP-dependent RNA helicase 14	65.300%	Swiss-Prot	High
`Q5JKF2`	Oryza sativa subsp. japonica	sp\|Q5JKF2\|RH40_ORYSJ DEAD-box ATP-dependent RNA helicase 40	68.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card