TkA02G507640 | RubberDandelionOmics

Gene overview

TkA02G507640

Reference: TK1151 Chr: Chr02 Coordinates: 130257438-130261404 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2578 bp · TkA02G507640|TK1151|cDNA

CACCACGCTCACCCCTACCTCAACTATAACTTTTTCCGATATGACTCTACTCGCGTGGCAACAAAAAGAAAAGTTAAGTGAAACACGTGGAAGCGGGCCCCAATGCCGCTAACGTGGTGTGTAAATACCGCGAAAAAGTCAATCATTGACTGACTATGTGGCTTCTCTTTCCCGGATTATCCAGCCAACTTACATTACACACCTGCACCGAGGACGCCACTCTGCTCCAATCCCAATAAACCCCATTCACACCCCCTTTG...

CDS

Download CDS FASTA

2031 bp · TkA02G507640|TK1151|CDS

ATGCGCGTTTTATCTCCGGCATCACAGAACAGCGACGGGTGTGCTCCTCTCGCCAACGCCCAAAAACTCGAATGGAGGATGGAGAATGAAAGAAACAATTGGCGATGGAGGCTGAAATCAAATGGAAACGAAGATGATGGTCGTTCCTCCGAGCTCAATCTCGTCGGCAAGCTGCAAACGAGGCTCCCCACCGACGGACACTGTATTTCACGGCGACAAGTGGTGATGGTCGGACCCCGCGCATACACACAGCACACACA...

Protein

Download Protein FASTA

676 aa · TkA02G507640|TK1151|PROTEIN

MRVLSPASQNSDGCAPLANAQKLEWRMENERNNWRWRLKSNGNEDDGRSSELNLVGKLQTRLPTDGHCISRRQVVMVGPRAYTQHTHIAVFLFLERSSLSLDSGSRYDGGGCWCGNGGLITTLPEFLTYHKSLMSLPQVSNYGVFCQNPCSRSLSSIHRSMSTSMCSLFWGKELCLINEGSVVGVSEKIQRGNAEKSRIIMVGDTLKKASASPGGSLIEIKDFSDAEKMMLEKSGLCSLVLERPFSPFPIQHLHHKSDLD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G507640`
TK1151 ID	TkA02G507640
OH-1004 ID	LXL04_013287
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	88.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G507640

Location Chr02:130257438-130261404 (-)

Description Similar to LSF1: Phosphoglucan phosphatase LSF1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g01510`	Starch granule-associated phosphoglucan phosphatase involved in the control of starch accumulation.	A putative phosphatase, LSF1, is required for normal starch turnover in Arabidopsis leaves.2010 · DOI: 10.1104/pp.109.148981

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013287 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000045 autophagosome assembly Biological Process

GO:0001558 regulation of cell growth Biological Process

GO:0001932 regulation of protein phosphorylation Biological Process

GO:0005977 glycogen metabolic process Biological Process

GO:0005978 glycogen biosynthetic process Biological Process

GO:0005982 starch metabolic process Biological Process

GO:0005983 starch catabolic process Biological Process

GO:0006470 protein dephosphorylation Biological Process

GO:0006816 calcium ion transport Biological Process

GO:0006914 autophagy Biological Process

GO:0007005 mitochondrion organization Biological Process

GO:0010468 regulation of gene expression Biological Process

KEGG gene cross-reference

ath:AT3G01510

ath:AT3G10940

ath:AT3G52180

rno:114005

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.915

Rank 1 · TkA02G507640 · TK1151

Mitochondrion0.061

Rank 2 · TkA02G507640 · TK1151

Cytoplasm0.059

Rank 3 · TkA02G507640 · TK1151

Nucleus0.056

Rank 4 · TkA02G507640 · TK1151

Cell membrane0.035

Rank 5 · TkA02G507640 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22785Tc-R-P393-493 aa

PF00782DSPc424-507 aa

PF04179Init_tRNA_PT447-498 aa

PF16561AMPK1_CBM542-623 aa

PF22058X25_BaPul_like573-604 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G507640	`PF22785`	Tc-R-P	393	493	0.018	16.3
TkA02G507640	`PF00782`	DSPc	424	507	4.9e-08	33.6
TkA02G507640	`PF04179`	Init_tRNA_PT	447	498	0.0044	17.9
TkA02G507640	`PF16561`	AMPK1_CBM	542	623	2.5e-20	73.2
TkA02G507640	`PF22058`	X25_BaPul_like	573	604	0.0085	16.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4J117`	Arabidopsis thaliana	sp\|F4J117\|LSF1_ARATH Phosphoglucan phosphatase LSF1, chloroplastic	72.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card