TkA02G495610 | RubberDandelionOmics

Gene overview

TkA02G495610

Reference: TK1151 Chr: Chr02 Coordinates: 126893265-126903090 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

6847 bp · TkA02G495610|TK1151|cDNA

ATTTTCCCACTGCTGCTTGTTTCCACACAGCAAAGCATATGCATACAAAGCAAATAAATTTCAAGAAACCTAGGATAATCTAGGATGAATCAAAACAGCAGGAAGAGATATGATATGAGGGATAATCCGGAGATGAGAGGATGTTACAAACCCACAGGCGACAGCAGGCTGGGGAGCTTTTTCCGGTGGAGCGACCGCCGAGAGCAAGTTGAGCACAGGAGAAGAGGGAGGCGACGTGAATAGGGTGCGTCTGCGTGGAG...

CDS

Download CDS FASTA

6015 bp · TkA02G495610|TK1151|CDS

ATGGGGAGCGCCGCTAAGCTTGTCGTGGACGCCCTGCTACAACGATTCCTTCCACTTGCTAGACGAAGGATCGAAACAACACAAGCACATGATGGACGCTACTTTCGGCCATTAGATCCAGCATATGAGCAAGTCCTGGATTCATTAGCTTTAGTCGCTCAACACATGCCTGTACCTCTTCTCGAAGCTCTTCTTCGCTGGAGAGAAACTGAATCCCCAAAAGGTGCAAACGATACATCTGCATTTCAGAAAAAGCTTGC...

Protein

Download Protein FASTA

2004 aa · TkA02G495610|TK1151|PROTEIN

MGSAAKLVVDALLQRFLPLARRRIETTQAHDGRYFRPLDPAYEQVLDSLALVAQHMPVPLLEALLRWRETESPKGANDTSAFQKKLAVECIFCSACTRFAQCCPADGLTERLWSVLEHFVFDWLINADRVVSQVDYPSLVDLRGLLLDLVAQLVGALSLSRFTSITGHFFMELNTRRIDTSGARTETLSIITGMRHIKLGVKTEGGINVSASFLAKANPLSRAPNKRKSELHHALCNMLSSILGPLADGGKGHWPPPGMH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G495610`
TK1151 ID	TkA02G495610
OH-1004 ID	LXL04_013444
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G495610`
Location	Chr02:126893265-126903090 (-)
Description	Similar to FRYL: Protein furry homolog-like
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_013444` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000902 cell morphogenesis Biological Process GO:0006351 DNA-templated transcription Biological Process GO:1904428 negative regulation of tubulin deacetylation Biological Process GO:0000922 spindle pole Cellular Component GO:0005813 centrosome Cellular Component GO:0005938 cell cortex Cellular Component GO:0030427 site of polarized growth Cellular Component GO:0004857 enzyme inhibitor activity Molecular Function
KEGG gene cross-reference	hsa:10129 hsa:285527 mmu:320365 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.488

Rank 1 · TkA02G495610 · TK1151

Nucleus0.323

Rank 2 · TkA02G495610 · TK1151

Golgi apparatus0.152

Rank 3 · TkA02G495610 · TK1151

Lysosome / Vacuole0.102

Rank 4 · TkA02G495610 · TK1151

Cell membrane0.093

Rank 5 · TkA02G495610 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14222MOR2-PAG1_N83-584 aa

PF14228MOR2-PAG1_mid596-1665 aa

PF10964DUF27661185-1230 aa

PF10964DUF27661381-1404 aa

PF14225MOR2-PAG1_C1481-1537 aa

PF04548AIG11507-1563 aa

PF14225MOR2-PAG1_C1631-1675 aa

PF14225MOR2-PAG1_C1690-1940 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G495610	`PF14222`	MOR2-PAG1_N	83	584	8.9e-89	299.6
TkA02G495610	`PF14228`	MOR2-PAG1_mid	596	1665		1820.2
TkA02G495610	`PF10964`	DUF2766	1185	1230	0.24	12.3
TkA02G495610	`PF10964`	DUF2766	1381	1404	0.24	12.3
TkA02G495610	`PF14225`	MOR2-PAG1_C	1481	1537	9.9e-50	170.3
TkA02G495610	`PF04548`	AIG1	1507	1563	0.32	11.0
TkA02G495610	`PF14225`	MOR2-PAG1_C	1631	1675	9.9e-50	170.3
TkA02G495610	`PF14225`	MOR2-PAG1_C	1690	1940	9.9e-50	170.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card