Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2070 bp · TkA02G495570|TK1151|cDNA
CACTGAACAGTGGATGAACAGAGGAAGTGAATCGGAACTGCAAATTATAAAGCAAAGCCTTCTCCTGCTTCCCTAACCGAATAATTTTTCTGAATTAGATCCTAAATTAAGCTTCTTAAGATGGATGCCACCAGCAACTATGACGCATCATCAGAATTCAGTAAAAGCAGCCTATCTTTAAAGACTTCTTCCGACAATGATAGTGTTCAAGGCTCTGAAAGCCCTGTAGATATCATAAAAAGATTCGAACTTGAAATATC...
1707 bp · TkA02G495570|TK1151|CDS
ATGGATGCCACCAGCAACTATGACGCATCATCAGAATTCAGTAAAAGCAGCCTATCTTTAAAGACTTCTTCCGACAATGATAGTGTTCAAGGCTCTGAAAGCCCTGTAGATATCATAAAAAGATTCGAACTTGAAATATCATATATTTGTGAGAAGCTAGCCAACTTGAACCTACTCTCAATGCGTGTAGAATCCAAAGAAAACGCCTTTGAGTCCCTCCTTCATGAAATGGACCCCGTTTTGGTAGTCAATGCACTAGA...
Protein
Download Protein FASTA568 aa · TkA02G495570|TK1151|PROTEIN
MDATSNYDASSEFSKSSLSLKTSSDNDSVQGSESPVDIIKRFELEISYICEKLANLNLLSMRVESKENAFESLLHEMDPVLVVNALEIDLLSGLLDSELKVLEKHISDIQIEKDHVMELLSSRKHLQESEPLMRMEDMLNDSGRTLEQSLEQILEIKIRSANFQRNLLRFGGDNENTESLEDTDLLELQEKMKLQNVEHQRHILRMLEKSWEREMDLEKKVNELNETKEDLTQKLKLSEQQVVSVQEEGEMTLEKLYEAN...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA02G495570 |
|---|---|
| TK1151 ID | TkA02G495570 |
| OH-1004 ID | LXL04_013445 |
| Relationship / confidence | Rbh Below Probable Coverage Or Synteny Threshold / Review |
| Protein identity (%) | 94.400 |
| Protein coverage (%) | TK1151 99.648 / OH-1004 45.941Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA02G495570 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr02:126881740-126884918 (-) | |||||||||
| Description | Similar to WIT1: WPP domain-interacting tail-anchored protein 1 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:2000769 regulation of establishment or maintenance of cell polarity regulating cell shape Biological Process GO:0005635 nuclear envelope Cellular Component GO:0005737 cytoplasm Cellular Component GO:0016020 membrane Cellular Component GO:0031965 nuclear membrane Cellular Component GO:0080115 myosin XI tail binding Molecular Function | |||||||||
| KEGG gene cross-reference | ath:AT1G68910 ath:AT5G11390 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00721TMV_coat26-63 aaPF26581WIT1_2_N34-170 aaPF25885HH_EMRA209-247 aaPF26581WIT1_2_N217-288 aaPF00721TMV_coat220-220 aaPF29762OWP_N226-296 aaPF25885HH_EMRA272-330 aaPF29762OWP_N294-335 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA02G495570 | PF00721 | TMV_coat | 26 | 63 | 0.35 | 11.9 |
| TkA02G495570 | PF26581 | WIT1_2_N | 34 | 170 | 3.9e-35 | 121.3 |
| TkA02G495570 | PF25885 | HH_EMRA | 209 | 247 | 0.15 | 13.1 |
| TkA02G495570 | PF26581 | WIT1_2_N | 217 | 288 | 3.9e-35 | 121.3 |
| TkA02G495570 | PF00721 | TMV_coat | 220 | 220 | 0.35 | 11.9 |
| TkA02G495570 | PF29762 | OWP_N | 226 | 296 | 0.11 | 14.1 |
| TkA02G495570 | PF25885 | HH_EMRA | 272 | 330 | 0.15 | 13.1 |
| TkA02G495570 | PF29762 | OWP_N | 294 | 335 | 0.11 | 14.1 |
| TkA02G495570 | PF26581 | WIT1_2_N | 319 | 364 | 3.9e-35 | 121.3 |
| TkA02G495570 | PF00721 | TMV_coat | 368 | 368 | 0.35 | 11.9 |
| TkA02G495570 | PF25885 | HH_EMRA | 380 | 451 | 0.15 | 13.1 |
| TkA02G495570 | PF26581 | WIT1_2_N | 401 | 454 | 3.9e-35 | 121.3 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.