TkA02G494110 | RubberDandelionOmics

Gene overview

TkA02G494110

Reference: TK1151 Chr: Chr02 Coordinates: 126484894-126487366 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

867 bp · TkA02G494110|TK1151|cDNA

CACGTGCCATCATCACTGCTTACTACTACAAAGTCCAAAGACGCCAGACACCACCGCTGCATCAACCGCTAAAATTCAGCCAAATACTTCACCAGATTTCCATCAGAATCTAAACGCCGGTTTCATCACAGATCACACACTAAAATCGATACAGACATGAAGTTTCTGTTGTGGAATAGCACCAGAAGCAATTCATTATCGTACTGCGTTAAAGAGAAGAAGCAATGTATTGGGTGGTGGGTCGACAAGTACTTCAACGA...

CDS

Download CDS FASTA

1125 bp · TkA02G494110|TK1151|CDS

ATGAAGTTTCTGTTGTGGAATAGCACCAGAAGCAATTCATTATCGTACTGCGTTAAAGAGAAGAAGCAATGTATTGGGTGGTGGGTCGACAAGTACTTCAACGATTGTCTATGCAATGTCAACGACGAAATTTCATTTGGATTGGGAATCATAAGCCTCGTCTGCTGGGGTGTGGCGGAAATCCCTCAAATCATCACCAACTTCCGCTCGAAATCAAGCCATGGCGTCTCCCTCATTTTCCTCCTTACGTGGATCGCCGG...

Protein

Download Protein FASTA

374 aa · TkA02G494110|TK1151|PROTEIN

MKFLLWNSTRSNSLSYCVKEKKQCIGWWVDKYFNDCLCNVNDEISFGLGIISLVCWGVAEIPQIITNFRSKSSHGVSLIFLLTWIAGDIFNLVGCVLEPATLPTQYYTALLYTASTVILVLQSLYYDHMYTWLRSRKADTTANPEVEEAKKPLRPKITNSQSHAIKASPSQRRDYYYMSARSLVGSSTPPNRSYLWTARSGPASAMAVDNDDSSEDESSVEIPKTASQPRPIPRSVGYGAFLATSLNLPSRTKGLMHVRK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G494110`
TK1151 ID	TkA02G494110
OH-1004 ID	LXL04_013478
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G494110`
Location	Chr02:126484894-126487366 (+)
Description	Similar to RTC2: Probable vacuolar amino acid transporter YPQ3 (Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_013478` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0010508 positive regulation of autophagy Biological Process GO:0015819 lysine transport Biological Process GO:0034488 basic amino acid transmembrane export from vacuole Biological Process GO:0034490 basic amino acid transmembrane import into vacuole Biological Process GO:0080144 intracellular amino acid homeostasis Biological Process GO:0090513 L-histidine transmembrane import into vacuole Biological Process GO:0090517 L-lysine transmembrane import into vacuole Biological Process GO:1903826 L-arginine transmembrane transport Biological Process GO:0005737 cytoplasm Cellular Component GO:0005739 mitochondrion Cellular Component GO:0005765 lysosomal membrane Cellular Component GO:0005783 endoplasmic reticulum Cellular Component
KEGG gene cross-reference	cel:CELE_Y43H11AL.2 sce:YBR147W sce:YDR352W sce:YOL092W These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.303

Rank 1 · TkA02G494110 · TK1151

Golgi apparatus0.261

Rank 2 · TkA02G494110 · TK1151

Endoplasmic reticulum0.179

Rank 3 · TkA02G494110 · TK1151

Cytoplasm0.162

Rank 4 · TkA02G494110 · TK1151

Cell membrane0.148

Rank 5 · TkA02G494110 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04193PQ-loop44-100 aa

PF24357TMD0_ABC49-98 aa

PF04193PQ-loop273-330 aa

PF24357TMD0_ABC320-369 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G494110	`PF04193`	PQ-loop	44	100	8.6e-37	125.4
TkA02G494110	`PF24357`	TMD0_ABC	49	98	0.043	14.7
TkA02G494110	`PF04193`	PQ-loop	273	330	8.6e-37	125.4
TkA02G494110	`PF24357`	TMD0_ABC	320	369	0.043	14.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card