TkA02G493670 | RubberDandelionOmics

Gene overview

TkA02G493670

Reference: TK1151 Chr: Chr02 Coordinates: 126225971-126227947 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1233 bp · TkA02G493670|TK1151|cDNA

GGCCATTCCAACAAGAGGTACTTGTTTGTGATTACAAAATAGGCAATTTTGATTATCGTGGTGTGAAAGCTCAAAGTCTGAAAGTTTAGGGCACGAAAATGTCACTTTTGAAGATTTTGAGATAATCATGACCAGATTCGTATACTTGAATTCCTAATTGATCTGACACAGTTGGGCAAGTTTACTACGAAACGGAGCAGCAGCGGAATCCATAGCGACGTGCAATCGGTAAACATCGGCTCTACAATAGGGTTCTTTCT...

CDS

Download CDS FASTA

324 bp · TkA02G493670|TK1151|CDS

ATGGTACATAAATATAAATGTTGCCCAACATCCAAAACCAATTCTGGCAAATCTCATCATTCCAAATTAGTTTTAGACCCTGGAGAAAGTGCATCTGATGAGAGAAATGCAAGAAGGGCAACACTGGAAAGCTCATTGCATGAAGTTTTATTCCAAATAATAAAATTTGTAAATGAAAAGAAAGATCATATTCCTCCAATACCAAACATGGAGGGAGTCTCATTTCCCTATGAGATTCATATACATTATTCATCAGATTC...

Protein

Download Protein FASTA

107 aa · TkA02G493670|TK1151|PROTEIN

MVHKYKCCPTSKTNSGKSHHSKLVLDPGESASDERNARRATLESSLHEVLFQIIKFVNEKKDHIPPIPNMEGVSFPYEIHIHYSSDSAFGMDMFKRMLQTGHPTMLS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G493670`
TK1151 ID	TkA02G493670
OH-1004 ID	LXL04_013497
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	88.300
Protein coverage (%)	TK1151 86.916 / OH-1004 45.175 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G493670

Location Chr02:126225971-126227947 (+)

Description Similar to ATG101: Autophagy-related protein 101

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g66930`	Accessory protein involved in autophagy.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013497 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000045 autophagosome assembly Biological Process

GO:0006914 autophagy Biological Process

GO:0015031 protein transport Biological Process

GO:0016236 macroautophagy Biological Process

GO:0030435 sporulation resulting in formation of a cellular spore Biological Process

GO:0042594 response to starvation Biological Process

GO:0051321 meiotic cell cycle Biological Process

GO:0000407 phagophore assembly site Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005776 autophagosome Cellular Component

GO:0005829 cytosol Cellular Component

GO:0031410 cytoplasmic vesicle Cellular Component

KEGG gene cross-reference

ath:AT5G66930

dre:567680

spo:2542723

xla:446504

xtr:549574

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.749

Rank 1 · TkA02G493670 · TK1151

Cytoplasm0.302

Rank 2 · TkA02G493670 · TK1151

Cell membrane0.046

Rank 3 · TkA02G493670 · TK1151

Endoplasmic reticulum0.035

Rank 4 · TkA02G493670 · TK1151

Mitochondrion0.032

Rank 5 · TkA02G493670 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07855ATG10130-70 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G493670	`PF07855`	ATG101	30	70	1.3e-09	38.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4K265`	Arabidopsis thaliana	sp\|F4K265\|AT101_ARATH Autophagy-related protein 101	72.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card