TkA02G492760 | RubberDandelionOmics

Gene overview

TkA02G492760

Reference: TK1151 Chr: Chr02 Coordinates: 125983048-125988097 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1237 bp · TkA02G492760|TK1151|cDNA

GAACTGAATTTGCGAGATGGGTCTGACAAAGACAAAGACAATTAACCGAGTGAAGAGGTTGGGTTGGCATGATGGCCGTAGTTTATTATTATCATCATTATTATTATTCTACACCTTCTTCCCTCTCCATATGCATCCCTCCACCAGGAACCATTTAATCTCCTCCATCGCCACCCTCCCTTCCTCATCTTCTTCAATATCTTCTCCTCCACAATGATGCGCAGCGTCACAAGCTCCAGCTCTTCCAGAGGCATCGCCGC...

CDS

Download CDS FASTA

774 bp · TkA02G492760|TK1151|CDS

ATGATGCGCAGCGTCACAAGCTCCAGCTCTTCCAGAGGCATCGCCGCCATTGTAGGCGTTGGTCCCAATCTCGGCCATTCCGTCGCTCGAAAGTTCGCTCACGAAGGATACACCGTCGCCATCCTCGCCAGGGACCTAGCGAGATTGTCGAGATTTGCCGACGAAATAGCGCGGGAAGAGAAAGCGCAGGTGTTCGCTATTCGAATCGATTGCTCCGATACACAGAGCGTGAGAGAAGCATTCGAAGGTGTTCTGTCGTT...

Protein

Download Protein FASTA

257 aa · TkA02G492760|TK1151|PROTEIN

MMRSVTSSSSSRGIAAIVGVGPNLGHSVARKFAHEGYTVAILARDLARLSRFADEIAREEKAQVFAIRIDCSDTQSVREAFEGVLSLGFVEVLVYNAYQPIPWQYGRPSNFSDIRVDSFQKSLAVSTVGAFHCAQQVLPGMVERGRGTILFTGCAASLSGVAGFSELCCGKFALRGLSQCLAKEFSPRGVHIAHIIIDGLIGASRASSTMPQRSLVGTGGDGSIMDPDSVAQTYWYLHVQPRGAWTQEIDVRLPNSK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G492760`
TK1151 ID	TkA02G492760
OH-1004 ID	LXL04_013510
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G492760`
Location	Chr02:125983048-125988097 (+)
Description	Similar to SAV2478: Uncharacterized oxidoreductase SAV2478 (Staphylococcus aureus (strain Mu50 / ATCC 700699)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_013510` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0016020 membrane Cellular Component GO:0016616 oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor Molecular Function GO:0050255 ribitol 2-dehydrogenase (NAD+) activity Molecular Function
KEGG gene cross-reference	sam:MW2403 sas:SAS2370 sau:SA2266 sav:SAV2478 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.658

Rank 1 · TkA02G492760 · TK1151

Nucleus0.332

Rank 2 · TkA02G492760 · TK1151

Peroxisome0.133

Rank 3 · TkA02G492760 · TK1151

Mitochondrion0.097

Rank 4 · TkA02G492760 · TK1151

Plastid0.083

Rank 5 · TkA02G492760 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00106adh_short14-195 aa

PF01488Shikimate_DH15-59 aa

PF027373HCDH_N16-79 aa

PF08659KR16-84 aa

PF05368NmrA17-84 aa

PF13561adh_short_C224-237 aa

PF13460NAD_binding_1024-84 aa

PF08659KR136-156 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G492760	`PF00106`	adh_short	14	195	4.6e-31	108.5
TkA02G492760	`PF01488`	Shikimate_DH	15	59	0.17	12.7
TkA02G492760	`PF02737`	3HCDH_N	16	79	0.006	17.2
TkA02G492760	`PF08659`	KR	16	84	0.052	14.2
TkA02G492760	`PF05368`	NmrA	17	84	0.0037	17.6
TkA02G492760	`PF13561`	adh_short_C2	24	237	1.8e-20	74.3
TkA02G492760	`PF13460`	NAD_binding_10	24	84	0.039	14.6
TkA02G492760	`PF08659`	KR	136	156	0.052	14.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card