TkA02G483420 | RubberDandelionOmics

Gene overview

TkA02G483420

Reference: TK1151 Chr: Chr02 Coordinates: 123371288-123373980 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1450 bp · TkA02G483420|TK1151|cDNA

ATTACTTTATAATCTTAGGGCAAAAGTGAAGAAGCAACTAACTCGATGGACTAACAATGAAATTACAAGTTTGTAGACTCGGTGCTTACAGGAAAAGGCGGGTGAACGGCATTATATAGGGCAAAATTCGGCTAAATTCGTTACTACTTTCTGTAATCGATTGACACTTGTTCTAGGGTTTGAATCAGTGTTATTAAACGGATGCTGCGACGCTATCTCTGATTTCCCTTGAACGTACCGTTTCTGCCTTAAACGTCGTT...

CDS

Download CDS FASTA

861 bp · TkA02G483420|TK1151|CDS

ATGGGCGTACCTAAACAGAAGTGGACATCAGAAGAGGAAGCTGCACTTAAAGCTGGAATAGCCAAGTATGGACCAGGTAGATGGAGCACAATTCTCAAAGACTCAGAGTTTGCTTCTGTCTTGCATATGCGTTCCAATGTGGATCTTAAGGATAAATGGAGAAACATAAACTTCATGGGCAGTGGATATGGATCCCGTCAAAGATCTAGACCTCCAAAATCTCAACCAGTTCATAAACCTGAAAGCATATCAACTTCTTC...

Protein

Download Protein FASTA

286 aa · TkA02G483420|TK1151|PROTEIN

MGVPKQKWTSEEEAALKAGIAKYGPGRWSTILKDSEFASVLHMRSNVDLKDKWRNINFMGSGYGSRQRSRPPKSQPVHKPESISTSSKEEHNALISIPDPLPILALPVQIDDSKKPMPIQRLDSIILESIINLKESCGSSRAAIAEYIEKKQSTPPIFERLLKEELKALIDCGKLIKVKHRYRMATSCVKKRSSPSILEAKKEVVSGNNRKIITKAEIDAELEKMKKMTPQQAAEAAVKAVAEAEAAILEAERAEREAEL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G483420`
TK1151 ID	TkA02G483420
OH-1004 ID	LXL04_002396
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	40.900
Protein coverage (%)	TK1151 66.084 / OH-1004 42.572 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G483420

Location Chr02:123371288-123373980 (+)

Description Similar to At1g17520: Telomere repeat-binding factor 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g49950`	Binds preferentially double-stranded telomeric repeats.	Single-Myb-histone proteins from Arabidopsis thaliana: a quantitative study of telomere-binding specificity and kinetics.2009 · DOI: 10.1042/bj20082195

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002396 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006334 nucleosome assembly Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0000781 chromosome, telomeric region Cellular Component

GO:0000785 chromatin Cellular Component

GO:0000786 nucleosome Cellular Component

GO:0000791 euchromatin Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0032991 protein-containing complex Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003691 double-stranded telomeric DNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G17520

ath:AT1G49950

ath:AT1G72740

zma:542123

zma:542125

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.872

Rank 1 · TkA02G483420 · TK1151

Cytoplasm0.167

Rank 2 · TkA02G483420 · TK1151

Cell membrane0.033

Rank 3 · TkA02G483420 · TK1151

Endoplasmic reticulum0.023

Rank 4 · TkA02G483420 · TK1151

Plastid0.022

Rank 5 · TkA02G483420 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00249Myb_DNA-binding5-55 aa

PF23588HTH_CHD1_Hrp37-37 aa

PF13921Myb_DNA-bind_68-56 aa

PF08074CHDCT28-40 aa

PF00249Myb_DNA-binding87-95 aa

PF00538Linker_histone123-179 aa

PF13921Myb_DNA-bind_6130-153 aa

PF28722WHD_Sfc3_5th145-191 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G483420	`PF00249`	Myb_DNA-binding	5	55	3.6e-09	37.3
TkA02G483420	`PF23588`	HTH_CHD1_Hrp3	7	37	0.00023	21.8
TkA02G483420	`PF13921`	Myb_DNA-bind_6	8	56	4.8e-06	27.4
TkA02G483420	`PF08074`	CHDCT2	8	40	0.24	12.2
TkA02G483420	`PF00249`	Myb_DNA-binding	87	95	3.6e-09	37.3
TkA02G483420	`PF00538`	Linker_histone	123	179	4.7e-10	40.3
TkA02G483420	`PF13921`	Myb_DNA-bind_6	130	153	4.8e-06	27.4
TkA02G483420	`PF28722`	WHD_Sfc3_5th	145	191	0.093	13.7
TkA02G483420	`PF00538`	Linker_histone	208	229	4.7e-10	40.3
TkA02G483420	`PF28722`	WHD_Sfc3_5th	208	229	0.093	13.7
TkA02G483420	`PF14362`	DUF4407	215	279	1.2	9.0
TkA02G483420	`PF08074`	CHDCT2	231	253	0.24	12.2
TkA02G483420	`PF14346`	DUF4398	231	281	0.57	11.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VWK4`	Arabidopsis thaliana	sp\|Q8VWK4\|TRB1_ARATH Telomere repeat-binding factor 1	41.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card