TkA02G477580 | RubberDandelionOmics

Gene overview

TkA02G477580

Reference: TK1151 Chr: Chr02 Coordinates: 121890290-121897799 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2229 bp · TkA02G477580|TK1151|cDNA

ATTTTGTCTGCAATAGCGATACATGTCAAACACGCACACTGATACACATTTGAGGGCATCCATTGAAAGTGCTGCAGTGAAAGATTGTACCTTTCGCATCCAGTACTTGTACTTTCTTCTGGTGTGTGACGCTTTAAGAGATTGTACCTTTTCCTTCTGGTGTTGTACGGTGTCATGATGCTTCAGCCGTCTGCAGAAAAGGAAAACTATCGACATAAAGACAACAAAGAAAAATCTCCAATGTGGAAATCGGAAACAGA...

CDS

Download CDS FASTA

1611 bp · TkA02G477580|TK1151|CDS

ATGATGCTTCAGCCGTCTGCAGAAAAGGAAAACTATCGACATAAAGACAACAAAGAAAAATCTCCAATGTGGAAATCGGAAACAGATAGCGTAGAGAGCGAGCTTTCCGATGCGAAAAGAGCAGTTCGGGATTTAACGTTAAAGATCGAAGAATCGAATTCGAGGGCAAAATTTCAGAGAAAACCGAAATGGCGGGAACAAGAAGAACCCGAGACTTCGTTTAGGAACGAGGATGATCGATATGAACAAGTGATGAAGGA...

Protein

Download Protein FASTA

536 aa · TkA02G477580|TK1151|PROTEIN

MMLQPSAEKENYRHKDNKEKSPMWKSETDSVESELSDAKRAVRDLTLKIEESNSRAKFQRKPKWREQEEPETSFRNEDDRYEQVMKELEHVKRELEKLKLDMARVFKEKRHAEREAKASNSKRSNLSASIVLMKKEIQELGEEQALVEFARIDAVKEWEAIEARRVEEANRYQAQVEENERTRQLQITLSDINLLESELNMAKEMDKRSEAMSRNQEDSPLNTITEELETAKRELASIKGEGFNFMASMDVIREELKHVR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G477580`
TK1151 ID	TkA02G477580
OH-1004 ID	LXL04_013699
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 99.627 / OH-1004 92.548 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G477580

Location Chr02:121890290-121897799 (+)

Description Similar to PMI2: Protein PLASTID MOVEMENT IMPAIRED 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g66840`	Required for the chloroplast avoidance response under high intensity blue light.	Two interacting coiled-coil proteins, WEB1 and PMI2, maintain the chloroplast photorelocation movement velocity in Arabidopsis.2010 · DOI: 10.1073/pnas.1007836107
`At5g38150`	Required for the chloroplast avoidance response under high intensity blue light.	Plastid movement impaired 2, a new gene involved in normal blue-light-induced chloroplast movements in Arabidopsis.2006 · DOI: 10.1104/pp.106.080333

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013699 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009637 response to blue light Biological Process

GO:0009903 chloroplast avoidance movement Biological Process

GO:0009904 chloroplast accumulation movement Biological Process

GO:0071260 cellular response to mechanical stimulus Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009536 plastid Cellular Component

KEGG gene cross-reference

ath:AT1G66840

ath:AT5G55860

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.620

Rank 1 · TkA02G477580 · TK1151

Nucleus0.319

Rank 2 · TkA02G477580 · TK1151

Cell membrane0.168

Rank 3 · TkA02G477580 · TK1151

Endoplasmic reticulum0.051

Rank 4 · TkA02G477580 · TK1151

Plastid0.047

Rank 5 · TkA02G477580 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF18818MPTase-PolyVal39-119 aa

PF05701WEMBL68-451 aa

PF22664TRI-like_N218-326 aa

PF18818MPTase-PolyVal255-273 aa

PF22664TRI-like_N339-368 aa

PF18818MPTase-PolyVal422-442 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G477580	`PF18818`	MPTase-PolyVal	39	119	0.93	10.3
TkA02G477580	`PF05701`	WEMBL	68	451	2.1e-09	37.4
TkA02G477580	`PF22664`	TRI-like_N	218	326	0.12	12.8
TkA02G477580	`PF18818`	MPTase-PolyVal	255	273	0.93	10.3
TkA02G477580	`PF22664`	TRI-like_N	339	368	0.12	12.8
TkA02G477580	`PF18818`	MPTase-PolyVal	422	442	0.93	10.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C9N6`	Arabidopsis thaliana	sp\|Q9C9N6\|PMI2_ARATH Protein PLASTID MOVEMENT IMPAIRED 2	36.200%	Swiss-Prot	Medium
`Q9FF41`	Arabidopsis thaliana	sp\|Q9FF41\|PMI15_ARATH Protein PLASTID MOVEMENT IMPAIRED 15	32.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card