TkA02G477400 | RubberDandelionOmics

Gene overview

TkA02G477400

Reference: TK1151 Chr: Chr02 Coordinates: 121848098-121850736 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2479 bp · TkA02G477400|TK1151|cDNA

AAAACTACCAATAAACCTTCATGAATTCAAACACAAAGCTCACCATTCCCAATGAAGTCCCAAATCATGTCTTGGTGTCCTTCGCCACTAATCATCATCAACTTGTTAATTCTAATTGTGGGTGAAACAGCTTCAAGCAGCTCACATGAATCTTACGATACATGTGCTGAATCATTCACCTGTGGTACTATTTCTGGTATCCGATACCCTTTCTTAAGACACCAAGATCCCACCTATTGTGGGTACCCTGGCTTTGAGCT...

CDS

Download CDS FASTA

2016 bp · TkA02G477400|TK1151|CDS

ATGAAGTCCCAAATCATGTCTTGGTGTCCTTCGCCACTAATCATCATCAACTTGTTAATTCTAATTGTGGGTGAAACAGCTTCAAGCAGCTCACATGAATCTTACGATACATGTGCTGAATCATTCACCTGTGGTACTATTTCTGGTATCCGATACCCTTTCTTAAGACACCAAGATCCCACCTATTGTGGGTACCCTGGCTTTGAGCTCGACTGTAAAGACAAAAATGCCCCTACCATCGACATCAACAACATGACGTA...

Protein

Download Protein FASTA

671 aa · TkA02G477400|TK1151|PROTEIN

MKSQIMSWCPSPLIIINLLILIVGETASSSSHESYDTCAESFTCGTISGIRYPFLRHQDPTYCGYPGFELDCKDKNAPTIDINNMTYHVLSIDQTSQVLKIVREDVKESICPHDFVNTSINPDLFAYSPAYMNITFLYGCPDSFNRHGDPLSCDDNGIDKVVVLPGEQGPGICNKSVIVPVPVMAMESTGLVNSTGLDQVLRGGFAVNWKLDAAGCSQCTQSNGRCFYNYDANRTSCACPGTPSVADTCVMANTTQTSSS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G477400`
TK1151 ID	TkA02G477400
OH-1004 ID	LXL04_007062
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	46.300
Protein coverage (%)	TK1151 96.125 / OH-1004 65.906 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G477400

Location Chr02:121848098-121850736 (-)

Description Similar to GAT1_2.1: Putative glutamine amidotransferase GAT1_2.1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g38210`	LEAF RUST 10 DISEASE-RESISTANCE LOCUS RECEPTOR-LIKE PROTEIN KINASE-like 1.3.	No verified direct reference in this release
`At1g66880`	LEAF RUST 10 DISEASE-RESISTANCE LOCUS RECEPTOR-LIKE PROTEIN KINASE-like 1.4.	No verified direct reference in this release
`At1g18390`	Probable receptor-like serine/threonine-protein kinase involved in abscisic acid (ABA) signaling.	The AtLRK10L1.2, Arabidopsis ortholog of wheat LRK10, is involved in ABA-mediated signaling and drought resistance.2015 · DOI: 10.1007/s00299-014-1724-2
`At1g25390`	LEAF RUST 10 DISEASE-RESISTANCE LOCUS RECEPTOR-LIKE PROTEIN KINASE-like 1.1.	No verified direct reference in this release
`At2g23450`	Serine/threonine-protein kinase that may function as a signaling receptor of extracellular matrix component.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007062 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0042631 cellular response to water deprivation Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0048573 photoperiodism, flowering Biological Process

GO:0071215 cellular response to abscisic acid stimulus Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:2000032 regulation of secondary shoot formation Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0016740 transferase activity Molecular Function

KEGG gene cross-reference

ath:AT1G15040

ath:AT1G18390

ath:AT1G66880

ath:AT5G38210

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.868

Rank 1 · TkA02G477400 · TK1151

Cytoplasm0.081

Rank 2 · TkA02G477400 · TK1151

Endoplasmic reticulum0.078

Rank 3 · TkA02G477400 · TK1151

Nucleus0.054

Rank 4 · TkA02G477400 · TK1151

Lysosome / Vacuole0.026

Rank 5 · TkA02G477400 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13947GUB_WAK_bind38-103 aa

PF13947GUB_WAK_bind151-157 aa

PF14380WAK_assoc169-241 aa

PF28757DOS_OSM_C214-251 aa

PF00069Pkinase359-629 aa

PF07714PK_Tyr_Ser-Thr361-631 aa

PF03109ABC1367-407 aa

PF06293Kdo456-502 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G477400	`PF13947`	GUB_WAK_bind	38	103	6.4e-17	62.4
TkA02G477400	`PF13947`	GUB_WAK_bind	151	157	6.4e-17	62.4
TkA02G477400	`PF14380`	WAK_assoc	169	241	3.5e-14	54.0
TkA02G477400	`PF28757`	DOS_OSM_C	214	251	0.45	11.4
TkA02G477400	`PF00069`	Pkinase	359	629	5.7e-46	157.7
TkA02G477400	`PF07714`	PK_Tyr_Ser-Thr	361	631	6.3e-47	160.8
TkA02G477400	`PF03109`	ABC1	367	407	2.3e-05	24.4
TkA02G477400	`PF06293`	Kdo	456	502	0.05	13.7
TkA02G477400	`PF14531`	Kinase-like	460	503	0.0084	16.1
TkA02G477400	`PF03109`	ABC1	471	505	2.3e-05	24.4
TkA02G477400	`PF13947`	GUB_WAK_bind	505	513	6.4e-17	62.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VYG0`	Arabidopsis thaliana	sp\|Q8VYG0\|LRL13_ARATH LEAF RUST 10 DISEASE-RESISTANCE LOCUS RECEPTOR-LIKE PROTEIN KINASE-like 1.3	45.400%	Swiss-Prot	Medium
`F4HQ17`	Arabidopsis thaliana	sp\|F4HQ17\|LRL14_ARATH LEAF RUST 10 DISEASE-RESISTANCE LOCUS RECEPTOR-LIKE PROTEIN KINASE-like 1.4	47.100%	Swiss-Prot	Medium
`P0C5E2`	Arabidopsis thaliana	sp\|P0C5E2\|LRL12_ARATH LEAF RUST 10 DISEASE-RESISTANCE LOCUS RECEPTOR-LIKE PROTEIN KINASE-like 1.2	43.600%	Swiss-Prot	Medium
`Q9C6K9`	Arabidopsis thaliana	sp\|Q9C6K9\|LRL11_ARATH LEAF RUST 10 DISEASE-RESISTANCE LOCUS RECEPTOR-LIKE PROTEIN KINASE-like 1.1	43.400%	Swiss-Prot	Medium
`Q8RY67`	Arabidopsis thaliana	sp\|Q8RY67\|WAKLO_ARATH Wall-associated receptor kinase-like 14	49.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card