Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1496 bp · TkA02G476570|TK1151|cDNA
TCGAGGCCTGCATTAGTAGTTAAGAACTTAAGATTATCGCAGATGCAGGACAGGAGTCAAAATCAGACCAGAGGGTGTGCACTAGGCTCCCAACTCCTGCCCTACAAGAATCAAAACTAATGGCAGGGATTGAAGTAAAAGGTTACGTGGTAGCAGCTCAATGGATGAACAAGCGATAAGCTCAAGTGTAACCACCTGTCTTTTTCTCTACATTTAAGAAGTATCCTTCTTCCTCTTCAACTGAGGCACATGGCGATGGC...
1134 bp · TkA02G476570|TK1151|CDS
ATGGCGATGGCTCCAATATGCTTTAAAATGTGCTACAAAAACCGAACTGTAAACAATGATCAAGATGTTTTTCGAGGCATCTCTCCAAATTCTATTGGCACTTTCATAAATCCAAACAAAAGCATGCTCAAATGTGCAAACTTTCCAAGATACATCTCTGCCAGTTCATCACAAAGGGAGAAACCTTTAGAATCTAGTTCTAGAGAAAAGCAATTAAGATCACTTGATTCTTACTTTAGGAAATCCAAGAACGATATGAC...
Protein
Download Protein FASTA377 aa · TkA02G476570|TK1151|PROTEIN
MAMAPICFKMCYKNRTVNNDQDVFRGISPNSIGTFINPNKSMLKCANFPRYISASSSQREKPLESSSREKQLRSLDSYFRKSKNDMTHNISGQSNKQLPLLNIYPVKNIQESQSKAGNQAVTKSESDETSGLYMISTIVSINIAVYLFEIASPIKNSDLELFSLPALYGAKINHLILYGEWWRLLTPMFLHTGIIHIGLGCWALLTFGPKVCRAYGPFTFFLIYILGGLSGNLTSFLHTPDPTVGGTGPVFAIIGAWLIY...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA02G476570 |
|---|---|
| TK1151 ID | TkA02G476570 |
| OH-1004 ID | LXL04_013718 |
| Relationship / confidence | Sequence Supported Annotation Or Model Conflict / Review |
| Protein identity (%) | 99.100 |
| Protein coverage (%) | TK1151 92.573 / OH-1004 58.754Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA02G476570 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr02:121619873-121622114 (+) | |||||||||
| Description | Similar to RBL9: RHOMBOID-like protein 9, chloroplastic | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006508 proteolysis Biological Process GO:0006654 phosphatidic acid biosynthetic process Biological Process GO:0019374 galactolipid metabolic process Biological Process GO:0046473 phosphatidic acid metabolic process Biological Process GO:0005886 plasma membrane Cellular Component GO:0009507 chloroplast Cellular Component GO:0009706 chloroplast inner membrane Cellular Component GO:0016020 membrane Cellular Component GO:0031969 chloroplast membrane Cellular Component GO:0004252 serine-type endopeptidase activity Molecular Function GO:0008236 serine-type peptidase activity Molecular Function | |||||||||
| KEGG gene cross-reference | ath:AT1G25290 ath:AT5G38510 bsu:BSU24870 dosa:Os05g0381400 psx:DR96_2293 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF01694Rhomboid129-149 aaPF04103CD20131-141 aaPF08551DUF1751168-237 aaPF01694Rhomboid179-317 aaPF04103CD20192-229 aaPF04103CD20247-361 aaPF01694Rhomboid348-362 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA02G476570 | PF01694 | Rhomboid | 129 | 149 | 8e-32 | 111.1 |
| TkA02G476570 | PF04103 | CD20 | 131 | 141 | 1.3 | 9.7 |
| TkA02G476570 | PF08551 | DUF1751 | 168 | 237 | 0.06 | 13.4 |
| TkA02G476570 | PF01694 | Rhomboid | 179 | 317 | 8e-32 | 111.1 |
| TkA02G476570 | PF04103 | CD20 | 192 | 229 | 1.3 | 9.7 |
| TkA02G476570 | PF04103 | CD20 | 247 | 361 | 1.3 | 9.7 |
| TkA02G476570 | PF01694 | Rhomboid | 348 | 362 | 8e-32 | 111.1 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.