TkA02G474760 | RubberDandelionOmics

Gene overview

TkA02G474760

Reference: TK1151 Chr: Chr02 Coordinates: 121181459-121183779 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1739 bp · TkA02G474760|TK1151|cDNA

TATAAACCTCTCGTTTTCTAGAAAATTGCGCCGTGCACACTTATCATTTCGGAGTTTTCAGAGCTATTTGCAATTTTCATCTTCATCAGGATTTTGAACAATTTAAGATGGACCCCAAAGAAGAAGTTCATAGTGACGATGGATCTTTCGAATTGGTCGACTTCGATGACAACGTGGGTCTATCCGATGAAGATTCTTATGACTTACTTTCTTCTGATATGTCTGATACACCTGAAGAAGAAGAAGAAGAAGATTCTAAT...

CDS

Download CDS FASTA

1488 bp · TkA02G474760|TK1151|CDS

ATGGACCCCAAAGAAGAAGTTCATAGTGACGATGGATCTTTCGAATTGGTCGACTTCGATGACAACGTGGGTCTATCCGATGAAGATTCTTATGACTTACTTTCTTCTGATATGTCTGATACACCTGAAGAAGAAGAAGAAGAAGATTCTAATAACACAACTGTTCACGAGGATAATATTTCTGCACAATTAAAATCCTCTCCACCCGATCCACCAAATGATGACCCGGGATCCATGTATTCATACAAATCTGATTCTTC...

Protein

Download Protein FASTA

495 aa · TkA02G474760|TK1151|PROTEIN

MDPKEEVHSDDGSFELVDFDDNVGLSDEDSYDLLSSDMSDTPEEEEEEDSNNTTVHEDNISAQLKSSPPDPPNDDPGSMYSYKSDSSKSESESEQEEEEELEEEEEEEEEEEEQLSYSNDKGKKRNFMTMAYDYSNFHPYEYPSHVKITENLTIKELARDQILRYLPAKSLARCRVVSKEWNSWISTPFFTHIQTQSFSQTSGFFQSQEYGPNRFISLDHFSYGVPDYPCLKFLPKETSIKSSCHGLLLCQAINDESEYY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G474760`
TK1151 ID	TkA02G474760
OH-1004 ID	LXL04_013734
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	98.800
Protein coverage (%)	TK1151 98.990 / OH-1004 33.794 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G474760`
Location	Chr02:121181459-121183779 (-)
Description	Similar to At5g07610: F-box protein At5g07610
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_013734` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0016567 protein ubiquitination Biological Process GO:0005634 nucleus Cellular Component
KEGG gene cross-reference	ath:AT5G07610 ath:AT5G49610 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.638

Rank 1 · TkA02G474760 · TK1151

Cytoplasm0.367

Rank 2 · TkA02G474760 · TK1151

Cell membrane0.101

Rank 3 · TkA02G474760 · TK1151

Endoplasmic reticulum0.074

Rank 4 · TkA02G474760 · TK1151

Lysosome / Vacuole0.025

Rank 5 · TkA02G474760 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29089Protamine-329-60 aa

PF21203ECM1050-111 aa

PF03348Serinc86-138 aa

PF15101TERB288-169 aa

PF29089Protamine-389-116 aa

PF00646F-box161-190 aa

PF12937F-box-like161-188 aa

PF03478Beta-prop_KIB1-4235-413 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G474760	`PF29089`	Protamine-3	29	60	2.5	9.0
TkA02G474760	`PF21203`	ECM10	50	111	9.4	8.0
TkA02G474760	`PF03348`	Serinc	86	138	3.8	7.0
TkA02G474760	`PF15101`	TERB2	88	169	0.068	13.8
TkA02G474760	`PF29089`	Protamine-3	89	116	2.5	9.0
TkA02G474760	`PF00646`	F-box	161	190	4.2e-07	30.3
TkA02G474760	`PF12937`	F-box-like	161	188	9.2e-06	26.0
TkA02G474760	`PF03478`	Beta-prop_KIB1-4	235	413	3.9e-07	30.6
TkA02G474760	`PF08268`	FBA_3	237	382	1.7e-06	28.0
TkA02G474760	`PF24750`	b-prop_At3g26010-like	238	368	4.2e-05	23.5
TkA02G474760	`PF07734`	FBA_1	241	380	2.3e-14	53.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card