TkA02G466210 | RubberDandelionOmics

Gene overview

TkA02G466210

Reference: TK1151 Chr: Chr02 Coordinates: 118885867-118895499 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1220 bp · TkA02G466210|TK1151|cDNA

ATGTGCGGATGGAGAGGATACGTCACCATTGAAGGTTGCGAGAAATTTTCAGCTACATATACGCGAGAGTGTCCATGGCGGCTTTGGCGGAAGCTGCTTGCTCGAGAGATTTTGGGGATATATGAGAAAGGAGATCGGAATTCAGAAATTGGTGGATGCGAGCTAATTAGGACGGTACATCTGTACCGATCGGAGGAAGGAGGGGAAGAAGTGGAGGTAGAAAGAGAGTATGTGTTTCATAAGGAGAGGGATTACGAGGA...

CDS

Download CDS FASTA

1047 bp · TkA02G466210|TK1151|CDS

ATGTGCGGATGGAGAGGATACGTCACCATTGAAGGTTGCGAGAAATTTTCAGCTACATATACGCGAGAGTGTCCATGGCGGCTTTGGCGGAAGCTGCTTGCTCGAGAGATTTTGGGGATATATGAGAAAGGAGATCGGAATTCAGAAATTGGTGGATGCGAGCTAATTAGGACGGTACATCTGTACCGATCGGAGGAAGGAGGGGAAGAAGTGGAGGTAGAAAGAGAGTATGTGTTTCATAAGGAGAGGGATTACGAGGA...

Protein

Download Protein FASTA

348 aa · TkA02G466210|TK1151|PROTEIN

MCGWRGYVTIEGCEKFSATYTRECPWRLWRKLLAREILGIYEKGDRNSEIGGCELIRTVHLYRSEEGGEEVEVEREYVFHKERDYEEISFCKVFTLKKFEVSSHFEGLVNGVWLCIYVFDATCSSPADIDRLPTVLTISRNQKLESIPTLANDLQTITQISCKGESEEDGEEDKDNRYKNHHMCDVDLNSLPYGLSENDESESATDVSGKKKRRAATKDIASLGLEDLAKYFDLPIIEASKNLKVGLTVLKKKCREFGIP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G466210`
TK1151 ID	TkA02G466210
OH-1004 ID	LXL04_013890
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 84.770 / OH-1004 91.615 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G466210

Location Chr02:118885867-118895499 (+)

Description Similar to RKD5: Protein RKD5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g35590`	Putative transcription factor.	No verified direct reference in this release
`At1g18790`	Putative transcription factor.	No verified direct reference in this release
`At5g53040`	Putative transcription factor.	No verified direct reference in this release
`At1g74480`	Putative transcription factor.	No verified direct reference in this release
`At5g66990`	Putative transcription factor.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013890 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0051302 regulation of cell division Biological Process

GO:0005634 nucleus Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

KEGG gene cross-reference

ath:AT1G18790

ath:AT1G74480

ath:AT4G35590

ath:AT5G53040

ath:AT5G66990

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.771

Rank 1 · TkA02G466210 · TK1151

Cytoplasm0.223

Rank 2 · TkA02G466210 · TK1151

Cell membrane0.061

Rank 3 · TkA02G466210 · TK1151

Endoplasmic reticulum0.040

Rank 4 · TkA02G466210 · TK1151

Plastid0.030

Rank 5 · TkA02G466210 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF19834DUF631426-115 aa

PF27400TP_0700143-165 aa

PF09726Macoilin151-215 aa

PF19834DUF6314173-214 aa

PF02042RWP-RK216-313 aa

PF27400TP_0700264-310 aa

PF09784L31265-336 aa

PF15455Pro-rich_19267-332 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G466210	`PF19834`	DUF6314	26	115	0.029	15.5
TkA02G466210	`PF27400`	TP_0700	143	165	0.2	12.3
TkA02G466210	`PF09726`	Macoilin	151	215	0.013	14.8
TkA02G466210	`PF19834`	DUF6314	173	214	0.029	15.5
TkA02G466210	`PF02042`	RWP-RK	216	313	1.6e-28	99.4
TkA02G466210	`PF27400`	TP_0700	264	310	0.2	12.3
TkA02G466210	`PF09784`	L31	265	336	0.15	13.2
TkA02G466210	`PF15455`	Pro-rich_19	267	332	0.2	11.5
TkA02G466210	`PF09726`	Macoilin	276	345	0.013	14.8
TkA02G466210	`PF19834`	DUF6314	284	319	0.029	15.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O81791`	Arabidopsis thaliana	sp\|O81791\|RKD5_ARATH Protein RKD5	46.300%	Swiss-Prot	Medium
`Q9M9U9`	Arabidopsis thaliana	sp\|Q9M9U9\|RKD1_ARATH Protein RKD1	41.700%	Swiss-Prot	Low
`Q9LVU8`	Arabidopsis thaliana	sp\|Q9LVU8\|RKD4_ARATH Protein RKD4	40.800%	Swiss-Prot	Low
`Q9CA66`	Arabidopsis thaliana	sp\|Q9CA66\|RKD2_ARATH Protein RKD2	43.500%	Swiss-Prot	Low
`Q9FGD1`	Arabidopsis thaliana	sp\|Q9FGD1\|RKD3_ARATH Protein RKD3	38.700%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card