TkA02G454090 | RubberDandelionOmics

Gene overview

TkA02G454090

Reference: TK1151 Chr: Chr02 Coordinates: 115638981-115641034 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1677 bp · TkA02G454090|TK1151|cDNA

TTCCATCAACTCTGTCTCCTGCTTTCCCTTTTCCACATTCTTTTAAACTTGAGAAACGGCCACGAAAACATCAATGGCTGCCACCCACAAAACACTCTTCATCATTCTAACCTACGCATTACTCGAATGGACCCTAATCGTAATGCTTCTTCTCAACTCTTTATTCTCATTTCTCATCAGAAAGTTTGCTACTTACTACGCCCTTAAACCACCCTGTTTTTGGTGTTCCGCCATTGATCATCTCTTGGAACCGAACAACG...

CDS

Download CDS FASTA

1311 bp · TkA02G454090|TK1151|CDS

ATGGCTGCCACCCACAAAACACTCTTCATCATTCTAACCTACGCATTACTCGAATGGACCCTAATCGTAATGCTTCTTCTCAACTCTTTATTCTCATTTCTCATCAGAAAGTTTGCTACTTACTACGCCCTTAAACCACCCTGTTTTTGGTGTTCCGCCATTGATCATCTCTTGGAACCGAACAACGACATAAACCCATTTCATATTCTCATCTGTGAAACACATGCGACTCAGTTAGTGAATCTTTATTACTGCCAAGA...

Protein

Download Protein FASTA

436 aa · TkA02G454090|TK1151|PROTEIN

MAATHKTLFIILTYALLEWTLIVMLLLNSLFSFLIRKFATYYALKPPCFWCSAIDHLLEPNNDINPFHILICETHATQLVNLYYCQDRQKVITEPRYVCKNGKCSCCSMKFKENCVDKLSNETSKIKSYYGDHEMVEAMDMENKSRHIQVFDQLIPLEWTDSSTSCSEGSSLNGDEIMVNKDEYQVKKQEGGFLQSSVCKDEEDKAATIHRLLSELKSERLAVCGLYIELNAERNASAIAANQALAMITRLQEDKIALQI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G454090`
TK1151 ID	TkA02G454090
OH-1004 ID	LXL04_014040
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 99.771 / OH-1004 95.395 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G454090

Location Chr02:115638981-115641034 (-)

Description Similar to MYOB3: Myosin-binding protein 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g74830`	Probable membrane-anchored myosin receptors.	No verified direct reference in this release
`At1g18990`	Probable membrane-anchored myosin receptors.	No verified direct reference in this release
`At1g70750`	Membrane-anchored myosin receptors that define a distinct, plant-specific transport vesicle compartment.	No verified direct reference in this release
`At2g30690`	Membrane-anchored myosin receptors that define a distinct, plant-specific transport vesicle compartment.	No verified direct reference in this release
`At5g16720`	Membrane-anchored myosin receptors that define a distinct, plant-specific transport vesicle compartment.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014040 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005737 cytoplasm Cellular Component

GO:0005811 lipid droplet Cellular Component

GO:0016020 membrane Cellular Component

GO:0030133 transport vesicle Cellular Component

GO:0017022 myosin binding Molecular Function

GO:0080115 myosin XI tail binding Molecular Function

KEGG gene cross-reference

ath:AT1G08800

ath:AT1G70750

ath:AT5G16720

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.402

Rank 1 · TkA02G454090 · TK1151

Nucleus0.360

Rank 2 · TkA02G454090 · TK1151

Cell membrane0.178

Rank 3 · TkA02G454090 · TK1151

Endoplasmic reticulum0.106

Rank 4 · TkA02G454090 · TK1151

Golgi apparatus0.080

Rank 5 · TkA02G454090 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF18699MRPL52199-220 aa

PF04576Zein-binding212-301 aa

PF18699MRPL52262-315 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G454090	`PF18699`	MRPL52	199	220	2.2	9.3
TkA02G454090	`PF04576`	Zein-binding	212	301	1.7e-25	89.9
TkA02G454090	`PF18699`	MRPL52	262	315	2.2	9.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4HVS6`	Arabidopsis thaliana	sp\|F4HVS6\|MYOB6_ARATH Probable myosin-binding protein 6	49.000%	Swiss-Prot	Low
`Q9LMC8`	Arabidopsis thaliana	sp\|Q9LMC8\|MYOB5_ARATH Probable myosin-binding protein 5	42.300%	Swiss-Prot	Low
`Q9CAC4`	Arabidopsis thaliana	sp\|Q9CAC4\|MYOB2_ARATH Myosin-binding protein 2	46.700%	Swiss-Prot	Low
`F4INW9`	Arabidopsis thaliana	sp\|F4INW9\|MYOB4_ARATH Probable myosin-binding protein 4	47.400%	Swiss-Prot	Low
`Q0WNW4`	Arabidopsis thaliana	sp\|Q0WNW4\|MYOB3_ARATH Myosin-binding protein 3	34.100%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card