TkA02G453930 | RubberDandelionOmics

Gene overview

TkA02G453930

Reference: TK1151 Chr: Chr02 Coordinates: 115594308-115599225 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2952 bp · TkA02G453930|TK1151|cDNA

ATGCAGGCAGAAAAACGATTATATAGCGATGAGCAAGACAGCCGTTTGTATAATATGGCTATAGTGATGGGGAATTGCAGATTACAGCCTCGACACATCCATTTGGGGATCGAATTAGGGCTTGGGTGGAAAAGCGACAAGGAAAAATATCGAAGACTTCGACGAGGACAATTCCGAGAAGGGGGTCCTCCCCAAAGGCCAAACCCCAGTTCAACCGCCATTGGTGCTCGCCCTCCTCCAGTCGGTCACCAGAACAGAAT...

CDS

Download CDS FASTA

2952 bp · TkA02G453930|TK1151|CDS

ATGCAGGCAGAAAAACGATTATATAGCGATGAGCAAGACAGCCGTTTGTATAATATGGCTATAGTGATGGGGAATTGCAGATTACAGCCTCGACACATCCATTTGGGGATCGAATTAGGGCTTGGGTGGAAAAGCGACAAGGAAAAATATCGAAGACTTCGACGAGGACAATTCCGAGAAGGGGGTCCTCCCCAAAGGCCAAACCCCAGTTCAACCGCCATTGGTGCTCGCCCTCCTCCAGTCGGTCACCAGAACAGAAT...

Protein

Download Protein FASTA

983 aa · TkA02G453930|TK1151|PROTEIN

MQAEKRLYSDEQDSRLYNMAIVMGNCRLQPRHIHLGIELGLGWKSDKEKYRRLRRGQFREGGPPQRPNPSSTAIGARPPPVGHQNRIRSKNPTVFHLIRHPPIPEKGMKTRNQAKRPRQSYGENDMIREAGDDPKTNGTRSNTPHKFQKRRGLKGKDINFDSASKLDSLTKGKEKQVKVNNDSEFTLEPKGCNGHFKLENSTPMEAKSELEDEMGDSDWEDGSNPNLNSENGHENHINKDISIEIDASPGTSKRKPIRRA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G453930`
TK1151 ID	TkA02G453930
OH-1004 ID	LXL04_014043
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	79.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G453930

Location Chr02:115594308-115599225 (+)

Description Similar to RAD4: DNA repair protein RAD4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g16630`	Essential protein.	CENTRIN2 interacts with the Arabidopsis homolog of the human XPC protein (AtRAD4) and contributes to efficient synthesis-dependent repair of bulky DNA lesions.2006 · DOI: 10.1007/s11103-006-0016-9 RAD4 and RAD23/HMR Contribute to Arabidopsis UV Tolerance.2017 · DOI: 10.3390/genes9010008

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014043 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000720 pyrimidine dimer repair by nucleotide-excision repair Biological Process

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0006281 DNA repair Biological Process

GO:0006289 nucleotide-excision repair Biological Process

GO:0006298 mismatch repair Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006974 DNA damage response Biological Process

GO:0009410 response to xenobiotic stimulus Biological Process

GO:0009411 response to UV Biological Process

GO:0009650 UV protection Biological Process

GO:0010224 response to UV-B Biological Process

GO:0010777 meiotic mismatch repair involved in reciprocal meiotic recombination Biological Process

KEGG gene cross-reference

ath:AT5G16630

dme:Dmel_CG8153

hsa:7508

mmu:22591

spo:2542967

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.955

Rank 1 · TkA02G453930 · TK1151

Cytoplasm0.085

Rank 2 · TkA02G453930 · TK1151

Cell membrane0.027

Rank 3 · TkA02G453930 · TK1151

Plastid0.015

Rank 4 · TkA02G453930 · TK1151

Endoplasmic reticulum0.013

Rank 5 · TkA02G453930 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01841Transglut_core242-282 aa

PF01841Transglut_core319-382 aa

PF16457PH_12417-480 aa

PF03835Rad4426-443 aa

PF10404BHD_2449-478 aa

PF03835Rad4551-650 aa

PF01841Transglut_core555-571 aa

PF01841Transglut_core580-602 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G453930	`PF01841`	Transglut_core	242	282	2e-07	32.0
TkA02G453930	`PF01841`	Transglut_core	319	382	2e-07	32.0
TkA02G453930	`PF16457`	PH_12	417	480	0.32	12.1
TkA02G453930	`PF03835`	Rad4	426	443	1e-20	74.6
TkA02G453930	`PF10404`	BHD_2	449	478	4e-14	53.8
TkA02G453930	`PF03835`	Rad4	551	650	1e-20	74.6
TkA02G453930	`PF01841`	Transglut_core	555	571	2e-07	32.0
TkA02G453930	`PF01841`	Transglut_core	580	602	2e-07	32.0
TkA02G453930	`PF10403`	BHD_1	664	713	2.5e-17	63.2
TkA02G453930	`PF10404`	BHD_2	717	779	4e-14	53.8
TkA02G453930	`PF10405`	BHD_3	786	858	5.1e-25	88.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8W489`	Arabidopsis thaliana	sp\|Q8W489\|RAD4_ARATH DNA repair protein RAD4	47.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card