TkA02G449230 | RubberDandelionOmics

Gene overview

TkA02G449230

Reference: TK1151 Chr: Chr02 Coordinates: 114254124-114259761 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4571 bp · TkA02G449230|TK1151|cDNA

AAAAAACAGTTATTTTAGACTGGGAGGACTACTGGTGGTGGCTGGTGTCCAAGCGGAACTGTGGATTAAGCCGCCGCTCAATCGGTAAATCAAACCGCCACGTGTCGGTCAACAATCAAATAGGGTTGCATTTCAGTCAGCCTGCGTCACGCACCACGCACCAGAAGCAGCTTCTTTTGCCTTCTTTCTCCCTCCCTGACTTCTTCCCCCTTTTCCTTCCAGCTTCCCAATTTCTGGCACAGGTCAAATCCCAAAACAAA...

CDS

Download CDS FASTA

3756 bp · TkA02G449230|TK1151|CDS

ATGGCTGATGACAGCAAACGCAAAAACCGGCTTACATCTGGGTTAGCTGTAATATTGGATGGTGAAAATAGGAAAAAGAGCTCCCAAAAAACCCATCTGATCTCATATTGTGATGATTTTGGCGAACAATCACTTGAGAGAACCCTAGAACACATATTTGAACTCCCATCCAAAACAATCAATCTTCTAACATCTCAAGTTGATGCTAATGTAATATCTTCCATTATAAAGAGCCATTACTTGAAGCAACACCATACATC...

Protein

Download Protein FASTA

1251 aa · TkA02G449230|TK1151|PROTEIN

MADDSKRKNRLTSGLAVILDGENRKKSSQKTHLISYCDDFGEQSLERTLEHIFELPSKTINLLTSQVDANVISSIIKSHYLKQHHTSSINTCREGVSAIVDSSGPSIVKLEESSVCGEFQVIKPPLLIESHAVFTSARASACVWKGKWMYEVTLETCGLQQLGWATVSCPFTEHTGVGDAEDSYAYDGKRVIKWNQNAEPYGQSWVVGDVIGCCIDLESDEISYYRNGVSLGVAFTGIRKMVPGLGYYPAVSLSQGERCD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G449230`
TK1151 ID	TkA02G449230
OH-1004 ID	LXL04_014169
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G449230

Location Chr02:114254124-114259761 (-)

Description Similar to RKP: E3 ubiquitin-protein ligase RKP

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g22010`	E3 ubiquitin-protein ligase that promotes the ubiquitination and proteasomal degradation of KRP1 and KRP2.	RKP, a RING finger E3 ligase induced by BSCTV C4 protein, affects geminivirus infection by regulation of the plant cell cycle.2009 · DOI: 10.1111/j.1365-313x.2008.03737.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014169 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000209 protein polyubiquitination Biological Process

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0009615 response to virus Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0019941 modification-dependent protein catabolic process Biological Process

GO:0030163 protein catabolic process Biological Process

GO:0051603 proteolysis involved in protein catabolic process Biological Process

GO:0051604 protein maturation Biological Process

GO:0051726 regulation of cell cycle Biological Process

GO:2000060 positive regulation of ubiquitin-dependent protein catabolic process Biological Process

GO:0000151 ubiquitin ligase complex Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT2G22010

hsa:63891

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.504

Rank 1 · TkA02G449230 · TK1151

Nucleus0.394

Rank 2 · TkA02G449230 · TK1151

Golgi apparatus0.099

Rank 3 · TkA02G449230 · TK1151

Cell membrane0.081

Rank 4 · TkA02G449230 · TK1151

Endoplasmic reticulum0.073

Rank 5 · TkA02G449230 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF19322RKP_N1-136 aa

PF25576TPR_RNF12345-80 aa

PF00622SPRY147-265 aa

PF10408Ufd2P_core660-949 aa

PF25576TPR_RNF123998-1188 aa

PF10408Ufd2P_core1018-1084 aa

PF00622SPRY1130-1145 aa

PF13920zf-C3HC4_31198-1242 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G449230	`PF19322`	RKP_N	1	136	5e-54	182.6
TkA02G449230	`PF25576`	TPR_RNF123	45	80	1.3e-80	270.8
TkA02G449230	`PF00622`	SPRY	147	265	1.7e-29	103.0
TkA02G449230	`PF10408`	Ufd2P_core	660	949	1.1e-09	38.0
TkA02G449230	`PF25576`	TPR_RNF123	998	1188	1.3e-80	270.8
TkA02G449230	`PF10408`	Ufd2P_core	1018	1084	1.1e-09	38.0
TkA02G449230	`PF00622`	SPRY	1130	1145	1.7e-29	103.0
TkA02G449230	`PF13920`	zf-C3HC4_3	1198	1242	5.3e-05	23.6
TkA02G449230	`PF13639`	zf-RING_2	1200	1239	0.9	10.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SIZ8`	Arabidopsis thaliana	sp\|Q9SIZ8\|RKP_ARATH E3 ubiquitin-protein ligase RKP	62.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card