Gene Card
Gene overview
cDNA / CDS / Protein Sequences
6888 bp · TkA02G444650|TK1151|cDNA
AAACATCTATATTAGCAATCAGTTGCAATCAATAAGTATCATAGCGTTTATAGAATCTTTATTTTCATGAAGGGTAAAAAAAGCTAAAGGAAAAGCAAAACGCAGGCTGCAAATATAAAAAGATAGGAAATGCAGCAGGCAGAAAGCAGTTGATATGATCATGAGAAGAAGGGAAAGGCCGCTCTTTCTCTTTCTGTAGACATGGAAGTCGAAGGAGGAAAACATGAATAAAGGGAAGTCTTTGTGGAGAGAGAGAGAGA...
6036 bp · TkA02G444650|TK1151|CDS
ATGAAACATTTGGATCAAAAAATGAAGAATAATAACGAATCGTCAACTAGTGATGTCATAAATGGAAATTGGGTTTTGAAACGTAAGCGGAAAAAGACGTCTTTTGGTCAAGTCAAAGTCAACTCAAATGGAAACAAACAAGATTCTACACCATCAGAGTCTCATACAAGTACATCCTCTAAATGCAAGATTGAAAAAGAGAATTCTTCCGATAGATCCCCTTCCAAAAAGAAAGGAAATGATGGGTCCTACTTTGAATG...
Protein
Download Protein FASTA2011 aa · TkA02G444650|TK1151|PROTEIN
MKHLDQKMKNNNESSTSDVINGNWVLKRKRKKTSFGQVKVNSNGNKQDSTPSESHTSTSSKCKIEKENSSDRSPSKKKGNDGSYFECVICDVGGDLLCCDGCPKTYHIGCLDPPLKKIPNGKWRCPNCCSETNSVEVVEKPETTSKRARTKVTSGKSKSKSKTSKTDKVSRILRSTGVKKKSSSKSKSSSLGPKVDISAIDGSLENSSSLLDIQKEKETDLELEETKPTSPEKDIKNEEKPKRKRERDRSKVKKDAHVSE...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA02G444650 |
|---|---|
| TK1151 ID | TkA02G444650 |
| OH-1004 ID | LXL04_014255 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 99.000 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA02G444650 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr02:112974009-112983149 (-) | |||||||||
| Description | Similar to CHR4: Protein CHROMATIN REMODELING 4 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process GO:0006338 chromatin remodeling Biological Process GO:0006357 regulation of transcription by RNA polymerase II Biological Process GO:0006366 transcription by RNA polymerase II Biological Process GO:0008285 negative regulation of cell population proliferation Biological Process GO:0009414 response to water deprivation Biological Process GO:0009733 response to auxin Biological Process GO:0009736 cytokinin-activated signaling pathway Biological Process GO:0009739 response to gibberellin Biological Process GO:0009788 negative regulation of abscisic acid-activated signaling pathway Biological Process GO:0009992 intracellular water homeostasis Biological Process GO:0035092 sperm DNA condensation Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT2G25170 ath:AT5G44800 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00628PHD87-128 aaPF23011PHD-1st_NSD87-128 aaPF23004PHDvar_NSD89-122 aaPF11496HDA2-3145-191 aaPF00385Chromo473-532 aaPF23615Chromo_MIT1473-515 aaPF00385Chromo548-600 aaPF23615Chromo_MIT1562-585 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA02G444650 | PF00628 | PHD | 87 | 128 | 1.5e-09 | 38.5 |
| TkA02G444650 | PF23011 | PHD-1st_NSD | 87 | 128 | 0.0055 | 17.5 |
| TkA02G444650 | PF23004 | PHDvar_NSD | 89 | 122 | 1.3 | 9.7 |
| TkA02G444650 | PF11496 | HDA2-3 | 145 | 191 | 6.4e-12 | 45.9 |
| TkA02G444650 | PF00385 | Chromo | 473 | 532 | 2.2e-17 | 63.5 |
| TkA02G444650 | PF23615 | Chromo_MIT1 | 473 | 515 | 0.002 | 19.3 |
| TkA02G444650 | PF00385 | Chromo | 548 | 600 | 2.2e-17 | 63.5 |
| TkA02G444650 | PF23615 | Chromo_MIT1 | 562 | 585 | 0.002 | 19.3 |
| TkA02G444650 | PF04851 | ResIII | 639 | 811 | 4.8e-10 | 40.3 |
| TkA02G444650 | PF00270 | DEAD | 642 | 812 | 2.3e-05 | 24.9 |
| TkA02G444650 | PF00176 | SNF2-rel_dom | 643 | 932 | 4.9e-77 | 259.6 |
| TkA02G444650 | PF13401 | AAA_22 | 666 | 811 | 0.28 | 12.2 |
| TkA02G444650 | PF11496 | HDA2-3 | 880 | 1096 | 6.4e-12 | 45.9 |
| TkA02G444650 | PF00271 | Helicase_C | 956 | 1070 | 8.2e-24 | 84.7 |
| TkA02G444650 | PF06465 | DUF1087 | 1243 | 1295 | 3.4e-07 | 31.0 |
| TkA02G444650 | PF00385 | Chromo | 1267 | 1277 | 2.2e-17 | 63.5 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.