TkA02G435990 | RubberDandelionOmics

Gene overview

TkA02G435990

Reference: TK1151 Chr: Chr02 Coordinates: 110804698-110806302 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1039 bp · TkA02G435990|TK1151|cDNA

TTTAAGAAAGCAACAACCCAAATAATTTCTTCAAATTCCCGCAAATTTCCTCATCCTTACACGTATCAGATACCAGCCGTTTCAAACCTGAGAGCATCTTCCACCATCCGATCATCAGCCGGCGGTCAAACTTTTGATCGGAGAACGGTGACCGGAGGGCAACAAAGAGGTACTGGAATCGGGAAAGCTTTGAAATGGTGGGAGAAAGGACTTAAACCGAACATGAAGGAGGTGACCGGCGCAGAGGATCTCGTCAGCTC...

CDS

Download CDS FASTA

804 bp · TkA02G435990|TK1151|CDS

ATGGCTGATGTCATCGGGAAGATCAGTACTAGTTTTAAGTTTTCACCTCGCATTAATGATTATTCATGTGATTGTTCTAAGAAGCTTTCGCCGGTGATGATTCAGATACCAGCCGTTTCAAACCTGAGAGCATCTTCCACCATCCGATCATCAGCCGGCGGTCAAACTTTTGATCGGAGAACGGTGACCGGAGGGCAACAAAGAGGTACTGGAATCGGGAAAGCTTTGAAATGGTGGGAGAAAGGACTTAAACCGAACAT...

Protein

Download Protein FASTA

267 aa · TkA02G435990|TK1151|PROTEIN

MADVIGKISTSFKFSPRINDYSCDCSKKLSPVMIQIPAVSNLRASSTIRSSAGGQTFDRRTVTGGQQRGTGIGKALKWWEKGLKPNMKEVTGAEDLVSSLVNAGDKLVIVDFFSPGCGGCRALHPKICQLAEMNPDVEFLQVNYEEHKSMCYSLNVHVLPFFRFYRGVDGRVCSFSCTNATIKKFKDALAKHTSSRCSLGRAKGLEEKELLALGSNRDLSFTYGPKPNQPQTIVPAVSISVSAVSKPSLPLPLPLPLPIK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G435990`
TK1151 ID	TkA02G435990
OH-1004 ID	LXL04_014354
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	98.800
Protein coverage (%)	TK1151 89.888 / OH-1004 77.419 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G435990

Location Chr02:110804698-110806302 (-)

Description Similar to At1g08570: Thioredoxin-like 1-1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g08570`	Thiol-disulfide oxidoreductase that may participate in various redox reactions.	No verified direct reference in this release
`At2g33270`	Probable thiol-disulfide oxidoreductase that may participate in various redox reactions.	No verified direct reference in this release
`At5g61440`	Probable thiol-disulfide oxidoreductase that may participate in various redox reactions.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0326500`	Probable thiol-disulfide oxidoreductase that may participate in various redox reactions.	No verified direct reference in this release
`Os07g0684100`	Probable thiol-disulfide oxidoreductase that may participate in various redox reactions.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014354 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0045454 cell redox homeostasis Biological Process

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0031969 chloroplast membrane Cellular Component

GO:0016671 oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor Molecular Function

KEGG gene cross-reference

ath:AT1G08570

ath:AT2G33270

ath:AT5G61440

dosa:Os03g0326500

dosa:Os07g0684100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.966

Rank 1 · TkA02G435990 · TK1151

Nucleus0.034

Rank 2 · TkA02G435990 · TK1151

Mitochondrion0.029

Rank 3 · TkA02G435990 · TK1151

Cytoplasm0.020

Rank 4 · TkA02G435990 · TK1151

Cell membrane0.018

Rank 5 · TkA02G435990 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13905Thioredoxin_820-35 aa

PF00085Thioredoxin99-169 aa

PF13098Thioredoxin_2103-141 aa

PF13905Thioredoxin_8105-153 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G435990	`PF13905`	Thioredoxin_8	20	35	0.0012	19.9
TkA02G435990	`PF00085`	Thioredoxin	99	169	2.2e-13	50.8
TkA02G435990	`PF13098`	Thioredoxin_2	103	141	0.03	15.3
TkA02G435990	`PF13905`	Thioredoxin_8	105	153	0.0012	19.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O64654`	Arabidopsis thaliana	sp\|O64654\|TRL11_ARATH Thioredoxin-like 1-1, chloroplastic	80.100%	Swiss-Prot	Medium
`O22779`	Arabidopsis thaliana	sp\|O22779\|TRL13_ARATH Thioredoxin-like 1-3, chloroplastic	73.000%	Swiss-Prot	Medium
`Q9XFI1`	Arabidopsis thaliana	sp\|Q9XFI1\|TRL12_ARATH Thioredoxin-like 1-2, chloroplastic	60.000%	Swiss-Prot	Medium
`Q10M18`	Oryza sativa subsp. japonica	sp\|Q10M18\|TRL12_ORYSJ Thioredoxin-like 1-2, chloroplastic	74.400%	Swiss-Prot	Medium
`Q6Z4N3`	Oryza sativa subsp. japonica	sp\|Q6Z4N3\|TRL11_ORYSJ Thioredoxin-like 1-1, chloroplastic	75.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card